ID: 1035417745

View in Genome Browser
Species Human (GRCh38)
Location 7:158704400-158704422
Sequence GAGGGGACACTCTCTGAGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035417741_1035417745 -9 Left 1035417741 7:158704386-158704408 CCATGCCCAGGACTGAGGGGACA 0: 2
1: 3
2: 17
3: 41
4: 315
Right 1035417745 7:158704400-158704422 GAGGGGACACTCTCTGAGGACGG No data
1035417733_1035417745 26 Left 1035417733 7:158704351-158704373 CCAGGACAGAGGAGGTCGCTCTC 0: 1
1: 1
2: 2
3: 20
4: 145
Right 1035417745 7:158704400-158704422 GAGGGGACACTCTCTGAGGACGG No data
1035417732_1035417745 27 Left 1035417732 7:158704350-158704372 CCCAGGACAGAGGAGGTCGCTCT 0: 1
1: 1
2: 1
3: 17
4: 167
Right 1035417745 7:158704400-158704422 GAGGGGACACTCTCTGAGGACGG No data
1035417740_1035417745 -8 Left 1035417740 7:158704385-158704407 CCCATGCCCAGGACTGAGGGGAC 0: 5
1: 0
2: 7
3: 32
4: 236
Right 1035417745 7:158704400-158704422 GAGGGGACACTCTCTGAGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035417745 Original CRISPR GAGGGGACACTCTCTGAGGA CGG Intronic
No off target data available for this crispr