ID: 1035419096

View in Genome Browser
Species Human (GRCh38)
Location 7:158712144-158712166
Sequence GAGGCCAGACCCATGGATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035419096_1035419103 4 Left 1035419096 7:158712144-158712166 CCCATATCCATGGGTCTGGCCTC No data
Right 1035419103 7:158712171-158712193 ACAACGTGAGCCAGAGTCCTGGG No data
1035419096_1035419102 3 Left 1035419096 7:158712144-158712166 CCCATATCCATGGGTCTGGCCTC No data
Right 1035419102 7:158712170-158712192 GACAACGTGAGCCAGAGTCCTGG No data
1035419096_1035419104 7 Left 1035419096 7:158712144-158712166 CCCATATCCATGGGTCTGGCCTC No data
Right 1035419104 7:158712174-158712196 ACGTGAGCCAGAGTCCTGGGTGG No data
1035419096_1035419107 17 Left 1035419096 7:158712144-158712166 CCCATATCCATGGGTCTGGCCTC No data
Right 1035419107 7:158712184-158712206 GAGTCCTGGGTGGTGCCACAGGG No data
1035419096_1035419106 16 Left 1035419096 7:158712144-158712166 CCCATATCCATGGGTCTGGCCTC No data
Right 1035419106 7:158712183-158712205 AGAGTCCTGGGTGGTGCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035419096 Original CRISPR GAGGCCAGACCCATGGATAT GGG (reversed) Intergenic