ID: 1035419097

View in Genome Browser
Species Human (GRCh38)
Location 7:158712145-158712167
Sequence TGAGGCCAGACCCATGGATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035419097_1035419102 2 Left 1035419097 7:158712145-158712167 CCATATCCATGGGTCTGGCCTCA No data
Right 1035419102 7:158712170-158712192 GACAACGTGAGCCAGAGTCCTGG No data
1035419097_1035419106 15 Left 1035419097 7:158712145-158712167 CCATATCCATGGGTCTGGCCTCA No data
Right 1035419106 7:158712183-158712205 AGAGTCCTGGGTGGTGCCACAGG No data
1035419097_1035419107 16 Left 1035419097 7:158712145-158712167 CCATATCCATGGGTCTGGCCTCA No data
Right 1035419107 7:158712184-158712206 GAGTCCTGGGTGGTGCCACAGGG No data
1035419097_1035419104 6 Left 1035419097 7:158712145-158712167 CCATATCCATGGGTCTGGCCTCA No data
Right 1035419104 7:158712174-158712196 ACGTGAGCCAGAGTCCTGGGTGG No data
1035419097_1035419103 3 Left 1035419097 7:158712145-158712167 CCATATCCATGGGTCTGGCCTCA No data
Right 1035419103 7:158712171-158712193 ACAACGTGAGCCAGAGTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035419097 Original CRISPR TGAGGCCAGACCCATGGATA TGG (reversed) Intergenic