ID: 1035419101

View in Genome Browser
Species Human (GRCh38)
Location 7:158712163-158712185
Sequence TCTGGCTCACGTTGTCCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035419101_1035419111 27 Left 1035419101 7:158712163-158712185 CCTCAGGGACAACGTGAGCCAGA No data
Right 1035419111 7:158712213-158712235 GATGTTATAAAGGCTTCCTAAGG No data
1035419101_1035419107 -2 Left 1035419101 7:158712163-158712185 CCTCAGGGACAACGTGAGCCAGA No data
Right 1035419107 7:158712184-158712206 GAGTCCTGGGTGGTGCCACAGGG No data
1035419101_1035419110 17 Left 1035419101 7:158712163-158712185 CCTCAGGGACAACGTGAGCCAGA No data
Right 1035419110 7:158712203-158712225 AGGGCAGAAAGATGTTATAAAGG No data
1035419101_1035419112 28 Left 1035419101 7:158712163-158712185 CCTCAGGGACAACGTGAGCCAGA No data
Right 1035419112 7:158712214-158712236 ATGTTATAAAGGCTTCCTAAGGG No data
1035419101_1035419106 -3 Left 1035419101 7:158712163-158712185 CCTCAGGGACAACGTGAGCCAGA No data
Right 1035419106 7:158712183-158712205 AGAGTCCTGGGTGGTGCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035419101 Original CRISPR TCTGGCTCACGTTGTCCCTG AGG (reversed) Intergenic
No off target data available for this crispr