ID: 1035419105

View in Genome Browser
Species Human (GRCh38)
Location 7:158712181-158712203
Sequence TGTGGCACCACCCAGGACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035419105_1035419111 9 Left 1035419105 7:158712181-158712203 CCAGAGTCCTGGGTGGTGCCACA No data
Right 1035419111 7:158712213-158712235 GATGTTATAAAGGCTTCCTAAGG No data
1035419105_1035419110 -1 Left 1035419105 7:158712181-158712203 CCAGAGTCCTGGGTGGTGCCACA No data
Right 1035419110 7:158712203-158712225 AGGGCAGAAAGATGTTATAAAGG No data
1035419105_1035419113 16 Left 1035419105 7:158712181-158712203 CCAGAGTCCTGGGTGGTGCCACA No data
Right 1035419113 7:158712220-158712242 TAAAGGCTTCCTAAGGGTCGTGG No data
1035419105_1035419112 10 Left 1035419105 7:158712181-158712203 CCAGAGTCCTGGGTGGTGCCACA No data
Right 1035419112 7:158712214-158712236 ATGTTATAAAGGCTTCCTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035419105 Original CRISPR TGTGGCACCACCCAGGACTC TGG (reversed) Intergenic