ID: 1035419106

View in Genome Browser
Species Human (GRCh38)
Location 7:158712183-158712205
Sequence AGAGTCCTGGGTGGTGCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035419100_1035419106 9 Left 1035419100 7:158712151-158712173 CCATGGGTCTGGCCTCAGGGACA No data
Right 1035419106 7:158712183-158712205 AGAGTCCTGGGTGGTGCCACAGG No data
1035419101_1035419106 -3 Left 1035419101 7:158712163-158712185 CCTCAGGGACAACGTGAGCCAGA No data
Right 1035419106 7:158712183-158712205 AGAGTCCTGGGTGGTGCCACAGG No data
1035419096_1035419106 16 Left 1035419096 7:158712144-158712166 CCCATATCCATGGGTCTGGCCTC No data
Right 1035419106 7:158712183-158712205 AGAGTCCTGGGTGGTGCCACAGG No data
1035419097_1035419106 15 Left 1035419097 7:158712145-158712167 CCATATCCATGGGTCTGGCCTCA No data
Right 1035419106 7:158712183-158712205 AGAGTCCTGGGTGGTGCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035419106 Original CRISPR AGAGTCCTGGGTGGTGCCAC AGG Intergenic