ID: 1035419108

View in Genome Browser
Species Human (GRCh38)
Location 7:158712188-158712210
Sequence TCTGCCCTGTGGCACCACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035419108_1035419111 2 Left 1035419108 7:158712188-158712210 CCTGGGTGGTGCCACAGGGCAGA No data
Right 1035419111 7:158712213-158712235 GATGTTATAAAGGCTTCCTAAGG No data
1035419108_1035419112 3 Left 1035419108 7:158712188-158712210 CCTGGGTGGTGCCACAGGGCAGA No data
Right 1035419112 7:158712214-158712236 ATGTTATAAAGGCTTCCTAAGGG No data
1035419108_1035419110 -8 Left 1035419108 7:158712188-158712210 CCTGGGTGGTGCCACAGGGCAGA No data
Right 1035419110 7:158712203-158712225 AGGGCAGAAAGATGTTATAAAGG No data
1035419108_1035419113 9 Left 1035419108 7:158712188-158712210 CCTGGGTGGTGCCACAGGGCAGA No data
Right 1035419113 7:158712220-158712242 TAAAGGCTTCCTAAGGGTCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035419108 Original CRISPR TCTGCCCTGTGGCACCACCC AGG (reversed) Intergenic