ID: 1035419112

View in Genome Browser
Species Human (GRCh38)
Location 7:158712214-158712236
Sequence ATGTTATAAAGGCTTCCTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035419108_1035419112 3 Left 1035419108 7:158712188-158712210 CCTGGGTGGTGCCACAGGGCAGA No data
Right 1035419112 7:158712214-158712236 ATGTTATAAAGGCTTCCTAAGGG No data
1035419105_1035419112 10 Left 1035419105 7:158712181-158712203 CCAGAGTCCTGGGTGGTGCCACA No data
Right 1035419112 7:158712214-158712236 ATGTTATAAAGGCTTCCTAAGGG No data
1035419109_1035419112 -8 Left 1035419109 7:158712199-158712221 CCACAGGGCAGAAAGATGTTATA No data
Right 1035419112 7:158712214-158712236 ATGTTATAAAGGCTTCCTAAGGG No data
1035419101_1035419112 28 Left 1035419101 7:158712163-158712185 CCTCAGGGACAACGTGAGCCAGA No data
Right 1035419112 7:158712214-158712236 ATGTTATAAAGGCTTCCTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035419112 Original CRISPR ATGTTATAAAGGCTTCCTAA GGG Intergenic