ID: 1035421219

View in Genome Browser
Species Human (GRCh38)
Location 7:158730205-158730227
Sequence ATGGACAGACAGATGGACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035421216_1035421219 -5 Left 1035421216 7:158730187-158730209 CCAGCACCAAGACGGATGATGGA No data
Right 1035421219 7:158730205-158730227 ATGGACAGACAGATGGACAAAGG No data
1035421213_1035421219 8 Left 1035421213 7:158730174-158730196 CCAGGTCTCAGCTCCAGCACCAA No data
Right 1035421219 7:158730205-158730227 ATGGACAGACAGATGGACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035421219 Original CRISPR ATGGACAGACAGATGGACAA AGG Intergenic
No off target data available for this crispr