ID: 1035421594

View in Genome Browser
Species Human (GRCh38)
Location 7:158733877-158733899
Sequence GCCTTGTTTATATATCACTG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 161}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035421594_1035421596 11 Left 1035421594 7:158733877-158733899 CCTCAGTGATATATAAACAAGGC 0: 1
1: 0
2: 2
3: 9
4: 161
Right 1035421596 7:158733911-158733933 ACAGACACATCCGACTCCTACGG 0: 1
1: 0
2: 0
3: 7
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035421594 Original CRISPR GCCTTGTTTATATATCACTG AGG (reversed) Exonic
900967490 1:5969058-5969080 GCCTTGTTTCTACAACCCTGGGG - Intronic
901463359 1:9404839-9404861 GTCTTGTTTATTTATCCTTGGGG + Intergenic
902737835 1:18413005-18413027 GCCTTGTGGATATATCTCTGAGG - Intergenic
905508001 1:38495373-38495395 GCCTTGTTGATACATCTCAGGGG - Intergenic
907666105 1:56435027-56435049 GCCATGTGTATTTTTCACTGGGG - Intergenic
908154869 1:61342332-61342354 CCCTGGTTTATAGATCACTGTGG + Intronic
910126011 1:83843292-83843314 GCCTAGATTATTTATCACTCAGG - Intergenic
910688962 1:89946843-89946865 TCATTGTTTATATCTAACTGTGG - Intergenic
910790648 1:91046393-91046415 GCATTGTGAAAATATCACTGTGG + Intergenic
914791862 1:150885282-150885304 GCCTTGTATATATATTTCTCTGG - Intergenic
916064324 1:161123860-161123882 GCCTTGGTTCTGGATCACTGAGG + Exonic
917647142 1:177040374-177040396 GCCTTGTTAACCTCTCACTGGGG + Intronic
918263793 1:182821164-182821186 GACTTGTATATATAGAACTGGGG - Intronic
920447049 1:206025425-206025447 GTCTTGTTGATCTTTCACTGGGG + Intergenic
1065975521 10:30838507-30838529 GTCTCCTTTATATATCACAGTGG - Intronic
1067913269 10:50368898-50368920 GCCTTGATTATATATTACTGTGG + Intronic
1067941999 10:50664784-50664806 GCTGTGTTTATATTTCACTAAGG - Intergenic
1070863239 10:79689731-79689753 GCTGTGTTTATATTTCACTAAGG - Intergenic
1071925282 10:90400297-90400319 GACATGTTTTTCTATCACTGAGG - Intergenic
1074682277 10:115919425-115919447 GCCTTCTGTACCTATCACTGAGG - Intronic
1077370791 11:2180683-2180705 GCCCTGTCTAAATATCACGGCGG - Intergenic
1079456301 11:20639329-20639351 GCCTTATATATATATTAGTGAGG - Intronic
1080765256 11:35290293-35290315 GCCTTAAATATACATCACTGTGG + Intronic
1080949334 11:37011913-37011935 TTCTTGTTTAAATATCAGTGTGG + Intergenic
1087059792 11:93966426-93966448 GACTTGTTAAAACATCACTGGGG + Intergenic
1087193534 11:95281956-95281978 GTATTGTTTATTAATCACTGTGG - Intergenic
1087457243 11:98402709-98402731 GCTTGGTTTATAAGTCACTGTGG + Intergenic
1089429405 11:118409756-118409778 ACCTTGTTTAAATATCTTTGGGG - Exonic
1092249818 12:6887599-6887621 GCTTTGTTTATACATCATTGAGG - Intronic
1092295259 12:7191938-7191960 GCCTTTTTACTTTATCACTGTGG + Intronic
1092494932 12:8984053-8984075 GCATTGTTCATAGGTCACTGAGG + Intronic
1100910371 12:99354178-99354200 TCTTTAGTTATATATCACTGGGG + Intronic
1101014556 12:100486216-100486238 GTCTAGTATAAATATCACTGGGG - Intronic
1101261057 12:103030544-103030566 AACTTGTTTAAAGATCACTGAGG - Intergenic
1101531626 12:105578430-105578452 GCCGTGTTTCTATGTCACTTTGG - Intergenic
1102266240 12:111488236-111488258 GCCTTGTTTTTCTAGCCCTGGGG + Intronic
1103656621 12:122476109-122476131 TCATTCTGTATATATCACTGTGG + Intronic
1104154130 12:126114944-126114966 GCCATGTTAATTTATCACAGTGG - Intergenic
1104521132 12:129476383-129476405 GCCATATTTAAATATCATTGCGG + Intronic
1105559778 13:21479718-21479740 CCCTTGCTTATACATCACTGGGG + Intergenic
1111029216 13:82574110-82574132 GCTTTGTTTATTTATTAATGGGG + Intergenic
1111985519 13:95062382-95062404 GCATTGTTTGTTTAGCACTGGGG - Intronic
1116637046 14:47409905-47409927 ACCATGTTCACATATCACTGAGG + Intronic
1117136728 14:52742264-52742286 CCCTAGTTTATCTTTCACTGAGG + Intronic
1120949564 14:90028614-90028636 TCATTATTTATATATCACAGTGG - Intronic
1123810470 15:23920213-23920235 CCCTTTTTTATAATTCACTGTGG - Intergenic
1124061988 15:26302017-26302039 GCCCTGTTTCTCTATCACAGAGG + Intergenic
1128825210 15:70709125-70709147 GCCTTGTAAGTATATGACTGTGG - Intronic
1129655145 15:77519130-77519152 ATCTTTTTTCTATATCACTGAGG - Intergenic
1130538916 15:84807465-84807487 GGTTGGTTTATATATCTCTGGGG + Intergenic
1132215434 15:100058416-100058438 GCCTTGTTTATGTATTCCTCGGG + Intronic
1138001832 16:53288873-53288895 TCCTTTTTTATATTACACTGAGG - Intronic
1144664723 17:17094504-17094526 GGCTTGTGTATATTTCAGTGTGG + Intronic
1145257487 17:21334764-21334786 GCCTTGTTTGTAAGCCACTGGGG + Intergenic
1145319153 17:21753271-21753293 GCCTTGTTTGTAAGCCACTGGGG - Intergenic
1153397569 18:4641791-4641813 GCCTTGTTTTTCTATCACGATGG - Intergenic
1153991561 18:10405127-10405149 GCCCTGTTTTTATCTCAGTGCGG - Intergenic
1155275035 18:24178895-24178917 GTCTTGTTTATATATGATTAAGG - Intronic
1155285516 18:24284897-24284919 GCCTTCCTTAAATATCACTGTGG + Intronic
1156033574 18:32741785-32741807 GGTTTGTTTATGTATCACCGGGG - Intronic
1156190277 18:34711212-34711234 GCGTTGTTTACATATCACCCTGG + Intronic
1157164418 18:45345160-45345182 GCTTTCTTTATTTCTCACTGTGG - Intronic
1157898410 18:51490331-51490353 TCCTTGTTTATATTTTTCTGGGG - Intergenic
1158229610 18:55239281-55239303 ACCTTGGTTATATATCAGTTAGG + Intronic
1164036024 19:21456328-21456350 ACCTTGTTAATCTAACACTGGGG + Intronic
1164701657 19:30289069-30289091 GCATTGTTGACACATCACTGGGG + Intronic
1167734647 19:51285962-51285984 GCATAATTTATATATCACTAAGG - Intergenic
1168604768 19:57749744-57749766 GGCTTGTTTGAATAACACTGTGG - Intronic
926587816 2:14707918-14707940 GCCTTGAATATATATGGCTGGGG - Intergenic
927023460 2:19041652-19041674 GCTTTATTTATATATCTGTGAGG + Intergenic
928816970 2:35308575-35308597 GCCTTGTATTTATAACAATGAGG - Intergenic
928829931 2:35468595-35468617 GGTTTCTTTGTATATCACTGAGG + Intergenic
933065468 2:77788873-77788895 GCCTAATTAATATATCATTGTGG - Intergenic
935562929 2:104577158-104577180 GTCCTGTTTACACATCACTGAGG - Intergenic
939810845 2:146830291-146830313 TCCTTGTTTTTATAGCACTGGGG - Intergenic
940382894 2:153036307-153036329 GCCTTGGTTATATACCTCAGAGG + Intergenic
940684656 2:156831724-156831746 GCATTGTTTATAGATTACTTTGG - Intergenic
943967827 2:194360636-194360658 GATTTGTTTATGTGTCACTGTGG - Intergenic
944833302 2:203554565-203554587 GCCTTGTTTCTATTTCAATTAGG - Intergenic
946647844 2:221857781-221857803 GAATTGATTATATCTCACTGGGG - Intergenic
1168731268 20:83528-83550 GTATTGTTTATATTTCTCTGTGG - Intergenic
1168770212 20:409536-409558 GCCCTGTTTATAAATCTCTGTGG + Intronic
1169749102 20:8973672-8973694 TCCTTGTATATATATAGCTGAGG - Intergenic
1170477874 20:16734317-16734339 GTCTTGTTTATGTCTTACTGTGG + Intronic
1170900825 20:20461565-20461587 GCCTTCTTTAAATTCCACTGAGG + Intronic
1171169857 20:23006402-23006424 GCCTTATTTAAATATTTCTGTGG - Intergenic
1176970549 21:15260754-15260776 CATTTGTTTATATATCGCTGTGG - Intergenic
1177658834 21:24056135-24056157 GCCTTGTTTATAAATCACGGTGG + Intergenic
1182865043 22:33597147-33597169 GCCTGGTTTATAGTTCAGTGGGG - Intronic
949685635 3:6566478-6566500 GACTTGAATATATATTACTGTGG - Intergenic
952509339 3:34037850-34037872 GCCCTGTTTGAATATCCCTGAGG + Intergenic
952800167 3:37283281-37283303 GCCTTGTTTATATCTCTGGGTGG - Intronic
954022797 3:47757188-47757210 GCCTTGATCATAGCTCACTGCGG - Intronic
954460883 3:50626220-50626242 GCCCTGTCTATACCTCACTGTGG - Intronic
955064204 3:55520644-55520666 GCCTTGTGAACATTTCACTGGGG + Intronic
956016071 3:64884386-64884408 TCCTTATTTACATATCACCGTGG + Intergenic
957950333 3:87117647-87117669 GCATTATTTGTAAATCACTGTGG - Intergenic
958535703 3:95400017-95400039 ACCTAATTTATAAATCACTGGGG - Intergenic
960441826 3:117697983-117698005 GCCTTTTTTATATATATGTGAGG + Intergenic
961915134 3:130366320-130366342 GGCTTCTGTATATATCAGTGTGG + Intronic
964244471 3:154635070-154635092 GCTTTGTTTATATATTGTTGAGG + Intergenic
970938739 4:21606293-21606315 TCCTTTTTAACATATCACTGAGG + Intronic
971056612 4:22920476-22920498 GCCATGTTTATAAATCACAAAGG - Intergenic
971460434 4:26890172-26890194 GCCTAGTTTACAGATGACTGTGG - Intronic
975469353 4:74747387-74747409 TCCTTGTTTATATCTGACAGTGG + Intronic
975860827 4:78674982-78675004 TCCTTATTTACACATCACTGTGG - Intergenic
976914123 4:90348945-90348967 GCATTTTTTATTTATCTCTGTGG + Intronic
978295378 4:107198856-107198878 TACTTGTTTGTAGATCACTGAGG - Intronic
982794731 4:159630982-159631004 GCTTTGTTTATATATCAGTCTGG - Intergenic
983040242 4:162915973-162915995 GCTTTATTTATATAGCCCTGCGG - Intergenic
983278763 4:165653483-165653505 TCCTTGTTTATATATTCCTATGG - Intergenic
984161774 4:176261096-176261118 GCATGGTTTATCTGTCACTGGGG + Intronic
984390068 4:179118213-179118235 AACTTTTTTTTATATCACTGAGG - Intergenic
985616498 5:926006-926028 GCCTTATTCATGTATCACTCAGG - Intergenic
987596417 5:20005379-20005401 ACTTTGTTTATATATAAATGTGG - Intronic
988938445 5:36115811-36115833 TCCTGGTTTTGATATCACTGGGG + Intronic
991606800 5:68410498-68410520 TCTCTGTTTATATATCACTTGGG + Intergenic
992637326 5:78737308-78737330 TCATTTTTTATATATAACTGAGG + Intronic
993073978 5:83202809-83202831 GCTTTCTTTATATATCTCTTGGG + Intronic
993978150 5:94508103-94508125 TCCTTTTTTATGTCTCACTGTGG + Intronic
998343210 5:141436938-141436960 TCCTTGTTTAGATTTCACTATGG - Intronic
1000713887 5:164615801-164615823 TCCTTGCTTATATATCTATGTGG + Intergenic
1003726299 6:8769081-8769103 GCCTTGTTTACAGATCATAGAGG + Intergenic
1004905014 6:20229405-20229427 GCACTGGTTATATATCACTTGGG - Intergenic
1005806399 6:29477790-29477812 GCTTTGTTTATGGATCACAGAGG + Intergenic
1006449885 6:34099719-34099741 GCCTTGTTCTTTGATCACTGGGG - Intronic
1008387125 6:50904506-50904528 GCCTTCTTTAAATATCACCAAGG - Intergenic
1008429295 6:51396752-51396774 GACATCTATATATATCACTGTGG - Intergenic
1010167030 6:72927336-72927358 GACTTGTTCATATCTCACTTTGG + Intronic
1010552587 6:77241291-77241313 GCCTTGTGTATTTCTCACTATGG + Intergenic
1011140174 6:84145558-84145580 GCCTTGTTTTTTTATCTCTGGGG + Intronic
1012218665 6:96620957-96620979 GACTGGATTTTATATCACTGTGG + Intergenic
1012804120 6:103873762-103873784 GCCTTGTTTGTATTTTTCTGGGG - Intergenic
1013035140 6:106375080-106375102 ACCTTGTTTAAAGAGCACTGTGG + Intergenic
1013069441 6:106715295-106715317 TCCATGTTTTTATATCCCTGGGG + Intergenic
1014512027 6:122334498-122334520 TCCTTGTTCATTTATCAATGTGG - Intergenic
1019450769 7:1096573-1096595 GCCTTGATTTTATCTCACCGTGG - Intronic
1020177791 7:5896981-5897003 GCCTTGTTTATTTCTAAATGAGG + Intergenic
1020178903 7:5906086-5906108 TCCTGGTTTATATAACACTTTGG - Intronic
1020304030 7:6818942-6818964 TCCTGGTTTATATAACACTTTGG + Intronic
1020305126 7:6827993-6828015 GCCTTGTTTATTTCTAAATGAGG - Intergenic
1023729770 7:43179786-43179808 GGCTCTTTTATATAACACTGAGG - Intronic
1023765391 7:43505561-43505583 GCCTTGTTTTTGTACCACTTTGG + Intronic
1029245818 7:99200674-99200696 GCCTTGTTTATTTATTAATTGGG - Intronic
1029652615 7:101903873-101903895 GCCTTTTTTATAAATCTCTCAGG - Intronic
1030687701 7:112503873-112503895 GTCTTGGTTAAATTTCACTGTGG + Intergenic
1030783652 7:113633100-113633122 GCATTGTCTTTGTATCACTGAGG - Intergenic
1031713667 7:125080138-125080160 GCATTGTTTAAATGTCAATGAGG + Intergenic
1033030879 7:137825174-137825196 GTCTTGCTTATATATTACTTTGG + Intronic
1034307850 7:150060158-150060180 GCCTTGTTTATATAAGGCAGGGG + Intergenic
1034799000 7:154040511-154040533 GCCTTGTTTATATAAGGCAGGGG - Intronic
1035421594 7:158733877-158733899 GCCTTGTTTATATATCACTGAGG - Exonic
1040388493 8:46930806-46930828 AGCTTGTTTATATCTCAGTGAGG + Intergenic
1050299524 9:4242992-4243014 GCCTTGTATGTACATCAATGAGG + Intronic
1050441272 9:5666336-5666358 GCATTATTTATACATCTCTGTGG + Intronic
1051061416 9:13049347-13049369 GCCTTTTTCACATATCCCTGCGG - Intergenic
1052271876 9:26635816-26635838 TCCTGGTTTAGATATCACAGGGG - Intergenic
1055394294 9:75857262-75857284 GCCCTGTTTACATTTCCCTGTGG + Intergenic
1056696698 9:88862427-88862449 TTCTTTTTTATATATCATTGTGG - Intergenic
1056878020 9:90355572-90355594 GCCATTTTTATACATCGCTGAGG - Intergenic
1058111428 9:101034447-101034469 GACTTGTTTATGTAGCACAGCGG + Intronic
1060421954 9:123475627-123475649 GGCTTATTTATAAAGCACTGTGG + Intronic
1186311797 X:8328096-8328118 GCCTTCTTTCTAAATAACTGCGG - Intergenic
1186913618 X:14196033-14196055 GCCAACATTATATATCACTGTGG + Intergenic
1188294843 X:28434945-28434967 GCTTGCTTTATATAACACTGAGG - Intergenic
1188970607 X:36611116-36611138 GCCTTTTTTAAATAGCACTTTGG + Intergenic
1192035004 X:67553227-67553249 GTAATGTTTATATATGACTGAGG + Intronic
1194261499 X:91701036-91701058 ACCTGGTTTATATATTACTCAGG + Intergenic
1194401743 X:93445950-93445972 GCCCTGTTTGTATATATCTGGGG - Intergenic
1196934660 X:120717607-120717629 ACATTGTTTATATATCAGTTAGG - Intergenic
1198521764 X:137460330-137460352 TTCTTGTTTAAATATCAATGGGG - Intergenic
1198737954 X:139808183-139808205 CTCCTGTTTATATATCACTTTGG - Intronic
1200580150 Y:4939843-4939865 ACCTGGTTTATATATTACTCAGG + Intergenic