ID: 1035422508

View in Genome Browser
Species Human (GRCh38)
Location 7:158741454-158741476
Sequence CTCTCCCCCAGCGTGGGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 698
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 660}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035422500_1035422508 16 Left 1035422500 7:158741415-158741437 CCAAAGCATGCCGGCCTCATGCT 0: 1
1: 0
2: 0
3: 8
4: 94
Right 1035422508 7:158741454-158741476 CTCTCCCCCAGCGTGGGGTGGGG 0: 1
1: 0
2: 1
3: 36
4: 660
1035422501_1035422508 6 Left 1035422501 7:158741425-158741447 CCGGCCTCATGCTCTGCTGCGTT 0: 1
1: 0
2: 0
3: 17
4: 202
Right 1035422508 7:158741454-158741476 CTCTCCCCCAGCGTGGGGTGGGG 0: 1
1: 0
2: 1
3: 36
4: 660
1035422497_1035422508 21 Left 1035422497 7:158741410-158741432 CCTCCCCAAAGCATGCCGGCCTC 0: 1
1: 0
2: 1
3: 9
4: 160
Right 1035422508 7:158741454-158741476 CTCTCCCCCAGCGTGGGGTGGGG 0: 1
1: 0
2: 1
3: 36
4: 660
1035422496_1035422508 22 Left 1035422496 7:158741409-158741431 CCCTCCCCAAAGCATGCCGGCCT 0: 1
1: 0
2: 1
3: 15
4: 139
Right 1035422508 7:158741454-158741476 CTCTCCCCCAGCGTGGGGTGGGG 0: 1
1: 0
2: 1
3: 36
4: 660
1035422502_1035422508 2 Left 1035422502 7:158741429-158741451 CCTCATGCTCTGCTGCGTTAAAC 0: 1
1: 0
2: 0
3: 5
4: 64
Right 1035422508 7:158741454-158741476 CTCTCCCCCAGCGTGGGGTGGGG 0: 1
1: 0
2: 1
3: 36
4: 660
1035422498_1035422508 18 Left 1035422498 7:158741413-158741435 CCCCAAAGCATGCCGGCCTCATG 0: 1
1: 0
2: 1
3: 10
4: 104
Right 1035422508 7:158741454-158741476 CTCTCCCCCAGCGTGGGGTGGGG 0: 1
1: 0
2: 1
3: 36
4: 660
1035422499_1035422508 17 Left 1035422499 7:158741414-158741436 CCCAAAGCATGCCGGCCTCATGC 0: 1
1: 0
2: 0
3: 13
4: 83
Right 1035422508 7:158741454-158741476 CTCTCCCCCAGCGTGGGGTGGGG 0: 1
1: 0
2: 1
3: 36
4: 660
1035422494_1035422508 25 Left 1035422494 7:158741406-158741428 CCTCCCTCCCCAAAGCATGCCGG 0: 1
1: 0
2: 0
3: 15
4: 175
Right 1035422508 7:158741454-158741476 CTCTCCCCCAGCGTGGGGTGGGG 0: 1
1: 0
2: 1
3: 36
4: 660

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035422508 Original CRISPR CTCTCCCCCAGCGTGGGGTG GGG Intronic
900101255 1:963036-963058 CTCTCCAGGAGCCTGGGGTGTGG + Intronic
900172782 1:1277792-1277814 CTGTCCCCCAGGCTGGAGTGCGG - Intergenic
900229540 1:1549480-1549502 CTGTCCCCCAGGCTGGAGTGCGG - Intronic
900247676 1:1645412-1645434 CTGTCCCCCAGGCTGGAGTGCGG + Intronic
900258903 1:1712550-1712572 CTGTCCCCCAGGCTGGAGTGCGG + Intronic
900379826 1:2378245-2378267 CTCTGCCCCAGGGTGGTGGGGGG + Intronic
900518350 1:3093876-3093898 CTCTCCGCCCGAGTGGGATGGGG - Intronic
900882171 1:5390116-5390138 CTCTAACCCAGCGGGGGGCGGGG - Intergenic
901326523 1:8369162-8369184 CTGTCCCCCAGGCTGGAGTGCGG - Intronic
902175901 1:14650507-14650529 CTATCCCCCAGGCTGGAGTGTGG - Intronic
902302875 1:15514966-15514988 CTGTCACCCAGGGTGGAGTGCGG - Intronic
902353753 1:15880490-15880512 CTCTCGCCCAGGCTGGAGTGCGG + Intronic
902688588 1:18095382-18095404 ATCTTCCACAGCCTGGGGTGTGG + Intergenic
903668534 1:25022318-25022340 CTCGCCCACAGCAGGGGGTGGGG - Intergenic
903788297 1:25875566-25875588 CCCTCCCCCGGCTTGGGGCGGGG - Intergenic
903940040 1:26923505-26923527 CTCTCACCCAGGCTGGAGTGCGG + Intronic
904044451 1:27601712-27601734 CTGTCCCCCAACCTGGGGTGGGG - Intronic
904551952 1:31325954-31325976 CTCTTACCCAGGCTGGGGTGCGG - Intronic
904609116 1:31715419-31715441 CCCTCCTCCCGCGTGGGGTCAGG + Intergenic
905432379 1:37933681-37933703 CTGTCACCCAGGCTGGGGTGTGG - Intronic
905719651 1:40186119-40186141 CTGTCACCCAGGTTGGGGTGCGG - Intronic
905810457 1:40908974-40908996 CTCACCCCTAGCTTGGGGTTGGG + Intergenic
906044982 1:42822218-42822240 CTCTCGCCCAGGCTGGAGTGTGG + Intronic
906327952 1:44860036-44860058 CTGTCCCCCAGACTGGAGTGCGG + Intronic
906362841 1:45178385-45178407 CTATCACCCAGGGTGGAGTGTGG - Intronic
906431783 1:45761108-45761130 CTGTCACCCAGGCTGGGGTGTGG + Intergenic
906441691 1:45852396-45852418 CTGTCCCCCAGGCTGGAGTGTGG + Intronic
906636925 1:47416217-47416239 CTCTCCCCCGGCGGTGGTTGGGG + Exonic
906803154 1:48755131-48755153 CTATCCCCCACCCTTGGGTGTGG + Intronic
906982945 1:50650581-50650603 CTGTCACCCAGGGTGGAGTGCGG - Intronic
907033352 1:51194353-51194375 CTGTCACCCAGACTGGGGTGCGG + Intergenic
907237957 1:53064217-53064239 GTCTCCCCAAGCATGGAGTGGGG - Intronic
907304197 1:53504850-53504872 CCCTCACTCGGCGTGGGGTGGGG - Intergenic
907390825 1:54157170-54157192 AACTCTCCCAGCTTGGGGTGGGG - Intronic
907441398 1:54480693-54480715 CCCTTCCCCAGCTGGGGGTGGGG + Intergenic
907492345 1:54816172-54816194 CTCTCCCGCCCTGTGGGGTGCGG - Intronic
908130398 1:61069317-61069339 CTCTCACCCAGGCTGGTGTGTGG - Intronic
909649114 1:77953452-77953474 CTCTCGCCCAGGCTGGAGTGCGG - Intronic
910986546 1:93010615-93010637 CTGTCGCCCAGCCTGGAGTGCGG - Intergenic
911609755 1:99947743-99947765 CTCTCACCCAGGCTGGAGTGTGG - Intergenic
912994113 1:114516444-114516466 CTGTCCCCCAGGCTGGAGTGCGG + Intergenic
913970254 1:143409595-143409617 CTGTCGCCCAGCCTGGAGTGCGG + Intergenic
914064629 1:144235191-144235213 CTGTCGCCCAGCCTGGAGTGCGG + Intergenic
914114521 1:144731163-144731185 CTGTCGCCCAGCCTGGAGTGCGG - Intergenic
914665499 1:149829222-149829244 CTCTCACCCAGCCTAGGGTCAGG - Intergenic
914670266 1:149864572-149864594 CTCTCACCCAGCCTAGGGTCAGG + Intronic
914748512 1:150516209-150516231 CTCTCGCCCAGGCTGGAGTGCGG - Intergenic
914845422 1:151281356-151281378 CCCGCCCCCAGCATGGAGTGGGG - Intronic
914880694 1:151544331-151544353 CTGTCACCCAGGCTGGGGTGCGG + Intronic
915235011 1:154474121-154474143 CCCTCACCCTGTGTGGGGTGGGG + Intronic
915311395 1:155007493-155007515 CTGGCCCCCACCCTGGGGTGTGG + Intronic
915525856 1:156475841-156475863 CTCACCCCCAGCCAGGAGTGGGG - Intronic
916649181 1:166819145-166819167 CTTTCCCCCAGCTTATGGTGGGG - Intergenic
917104766 1:171481162-171481184 CTCTCACCCAGACTGGAGTGTGG - Intergenic
917121469 1:171648150-171648172 CTGTCCCCCAGGCTGGAGTGCGG - Intronic
917938197 1:179890632-179890654 CTCTCACCCAGGCTGGAGTGCGG + Intronic
917966843 1:180184181-180184203 CTGTCCCCCACCCTGGGGTCTGG + Intronic
918012978 1:180604825-180604847 CTGTCCCCCAGGCTGGAGTGCGG - Intergenic
918020357 1:180681702-180681724 CTCTCTCCCAGGCTGGGGTGTGG + Intronic
918096348 1:181338120-181338142 CTCTCACCCAGGCTGGAGTGCGG + Intergenic
918290401 1:183102041-183102063 CTCTGCCTCTGTGTGGGGTGGGG - Intronic
919908526 1:202095226-202095248 CTGTCACCCAGGGTGAGGTGTGG - Intergenic
920125797 1:203692873-203692895 CACCTCCCCAGCATGGGGTGGGG + Intronic
920201033 1:204259773-204259795 CTCTAGCCCAGCATGGAGTGGGG + Intronic
920342154 1:205282105-205282127 CTGTCGCCCAGGCTGGGGTGCGG - Intergenic
920702872 1:208231121-208231143 CTCTCCCTCACAGTGGGCTGAGG - Intronic
921583803 1:216925398-216925420 CTGTCCCCCAGGCTGGAGTGTGG - Intronic
922176923 1:223204023-223204045 CTCTCAGCCAGGGTTGGGTGGGG + Intergenic
922305866 1:224343986-224344008 CTGTCACCCAGCCTGGAGTGTGG - Intergenic
922349198 1:224721959-224721981 CTCTCCCACGGGGTGGTGTGTGG + Intronic
922769918 1:228176162-228176184 CCCTCCAGGAGCGTGGGGTGGGG + Exonic
923626494 1:235617846-235617868 CTGTCGCCCAGGGTGGAGTGCGG - Intronic
923739911 1:236645772-236645794 CTGTCCCCCAGGCTGGAGTGTGG - Intergenic
924290108 1:242527165-242527187 CTCTCACCCAGGCTGGAGTGCGG + Intergenic
1063174412 10:3538884-3538906 CTCTCTCCCAGCGTCAGCTGTGG + Intergenic
1063409368 10:5825084-5825106 CTGTCACCCAGGCTGGGGTGCGG - Intronic
1063846260 10:10130195-10130217 CTGTCACCCAGCCTGGAGTGTGG - Intergenic
1064168983 10:13012732-13012754 CTGTCCCCCAGGCTGGAGTGCGG - Intronic
1064289605 10:14021518-14021540 CTATCCCCCAGGCTGGAGTGTGG - Intronic
1064394015 10:14966098-14966120 CTGTCACCCAGCTTGGAGTGCGG + Intronic
1064526193 10:16259433-16259455 CTGTCACCCAGCCTGGAGTGCGG + Intergenic
1065284468 10:24174355-24174377 CTCTCCCCTAGGGTCTGGTGTGG - Intronic
1066383055 10:34918148-34918170 CTCTTCCCCAGAGGTGGGTGTGG - Intergenic
1066652786 10:37674414-37674436 CTGTCCCCCAGGCTGGAGTGTGG - Intergenic
1067238728 10:44472780-44472802 CTCTCCCCCAGCCCCTGGTGTGG + Intergenic
1067317300 10:45180675-45180697 CGCCCCTTCAGCGTGGGGTGTGG + Intergenic
1067713634 10:48670800-48670822 CCCTCCACCAGCGGGGGGTGGGG + Intergenic
1069484931 10:68816008-68816030 CTCTCACCCAGGCTGGAGTGCGG - Intergenic
1069735064 10:70648566-70648588 CTGTCCCCCAGGGTGGGGATGGG + Intergenic
1069735655 10:70652441-70652463 CTCTCCCCAAGTGGTGGGTGAGG + Intergenic
1070617442 10:77979661-77979683 CTCTACCCACCCGTGGGGTGTGG - Intronic
1070649169 10:78222546-78222568 ATCGCCCCCACTGTGGGGTGAGG + Intergenic
1070785559 10:79160310-79160332 CTCTCCCCATGGCTGGGGTGGGG + Intronic
1071541648 10:86490175-86490197 CTGTCCCCCAGGCTGGAGTGTGG - Intronic
1071704247 10:87980282-87980304 CTGTCGCCCAGGCTGGGGTGTGG + Intergenic
1073176721 10:101561420-101561442 CTCTCCCCCAGCTTTGGGGCTGG + Intergenic
1073185521 10:101613150-101613172 CTCGGCCCCCGGGTGGGGTGAGG - Intronic
1073208338 10:101780290-101780312 TTCTCCCCCAGCCCGTGGTGAGG - Intronic
1073375716 10:103032412-103032434 CTGTCCCCCAGGTTGGAGTGCGG - Intronic
1074048331 10:109859939-109859961 CTATCCCTCAGCGTGGGGCTTGG + Intergenic
1075062262 10:119265392-119265414 CTAACCCCCAGTGTGAGGTGGGG + Intronic
1075495197 10:122914001-122914023 CTGTCCCCCAGGCTGGTGTGCGG + Intergenic
1075654356 10:124151634-124151656 CTCTGTCCCAGCGTGGGGTGGGG - Intergenic
1076016896 10:127034966-127034988 CTCTCCCTCAGTCTGGGGAGGGG - Intronic
1076226690 10:128782286-128782308 CTGTCACCCAGGCTGGGGTGCGG + Intergenic
1076478774 10:130770207-130770229 CTGCAGCCCAGCGTGGGGTGTGG - Intergenic
1077041436 11:525858-525880 CTGTCCCCCAGGCTGGAGTGTGG - Intergenic
1077075447 11:699257-699279 CTCTCACCCAGGCTGGAGTGTGG + Intronic
1077176830 11:1194940-1194962 CTGTCCCCCAGCTGGGGGTGGGG + Intronic
1077504288 11:2922899-2922921 CCCTCCCCCAGCACGGGGAGTGG + Intronic
1078112320 11:8406104-8406126 CTGTCACCCAGCCTGGAGTGCGG - Intronic
1078135601 11:8649300-8649322 CTGTCACCCAGGCTGGGGTGCGG - Intronic
1078918308 11:15801714-15801736 TTCTCCCACAGCCTGAGGTGTGG - Intergenic
1079011098 11:16829037-16829059 CTCTCACCCAGGCTGGAGTGCGG + Intronic
1079642455 11:22823764-22823786 CTATCGCCCAGGCTGGGGTGAGG + Intronic
1081487980 11:43546766-43546788 CCCTCCTCCAGCCTGGGGTTGGG - Intergenic
1082833693 11:57637901-57637923 CTCTCCCACCGCCTTGGGTGAGG + Intergenic
1083084124 11:60124982-60125004 CTCTCCCCAGGGGTGGGGAGGGG + Intergenic
1083272634 11:61580102-61580124 CTCTCTCCCGTCCTGGGGTGGGG - Intronic
1083668096 11:64286060-64286082 GCCTCCCCCAGCTTGGGGAGGGG + Intronic
1083851948 11:65373198-65373220 CTGTCACCCAGGCTGGGGTGCGG - Intergenic
1083890779 11:65594831-65594853 CTGTCACCCAGGCTGGGGTGCGG - Intronic
1083947289 11:65931312-65931334 TTCTTCCCCACCGTGGGCTGTGG + Intergenic
1084092694 11:66889035-66889057 CTGTCACCCAGGCTGGGGTGCGG - Intronic
1084157032 11:67318954-67318976 CTGTCACCCAGGCTGGGGTGCGG + Intronic
1084643720 11:70441966-70441988 CTGTCCCCCAGGCTGGAGTGGGG - Intergenic
1084757444 11:71248806-71248828 CCCCAACCCAGCGTGGGGTGGGG - Intronic
1084915350 11:72424847-72424869 CTGTCCCCCAGGTTGGAGTGCGG - Intronic
1085276382 11:75302818-75302840 CTCTCCCTGAGCAGGGGGTGGGG - Intronic
1085508380 11:77073027-77073049 CTCTCACCCGGGGTGGGGTGGGG - Intronic
1085608703 11:77926773-77926795 CTGTTCCCCAGGGTGGAGTGCGG - Intronic
1087358130 11:97121436-97121458 CTGTCCCCCAGGCTGGAGTGCGG - Intergenic
1087896849 11:103595514-103595536 CTCACCCCCAGGCTGGGGAGAGG - Intergenic
1088882098 11:113980434-113980456 ATGTCACCCAGCCTGGGGTGTGG + Intronic
1089556935 11:119320216-119320238 CTCTCTCCCATGGTGGTGTGGGG - Intronic
1090449794 11:126796393-126796415 CTGTCCCGCAGCATTGGGTGTGG + Intronic
1090993003 11:131837762-131837784 GGCTCCCCCAGCGTGGGGCCTGG - Intronic
1091235707 11:134020796-134020818 CTCTCCTCCACCGCGGGGTTAGG + Intergenic
1091379173 12:44838-44860 CTGTCACCCAGCCTGGAGTGCGG + Intergenic
1091542365 12:1473591-1473613 CTGTCCCCCAGGCTGGAGTGCGG - Intronic
1092984001 12:13827716-13827738 CTGTCGCCCAGGGTGGAGTGCGG + Intronic
1094322806 12:29203961-29203983 CTCTCTCCCAGGCTGGAGTGTGG - Intronic
1094619469 12:32066282-32066304 CTGTCACCCAGGGTGGAGTGTGG - Intergenic
1094624595 12:32111642-32111664 CTTTCACCCAGCCTGGAGTGCGG + Intronic
1095698547 12:45167016-45167038 CTATCCCCCAGTCTGGAGTGGGG - Intergenic
1095999439 12:48116513-48116535 CTGTCGCCCAGGGTGGAGTGTGG + Intronic
1096048016 12:48581456-48581478 CTGTCGCCCAGGCTGGGGTGCGG + Intergenic
1096168746 12:49448676-49448698 CTGTCACCCAGGGTGGAGTGCGG - Intronic
1096197523 12:49658172-49658194 GGCTCCCCCAGAGAGGGGTGAGG + Intronic
1096504029 12:52081631-52081653 CTCTCCCCCAGCAAAGGGAGGGG - Intergenic
1097095419 12:56543696-56543718 CTGTCCCCCAGGCTGGAGTGCGG + Intronic
1097167755 12:57094653-57094675 CCCTCCACCAGCGCGGGATGGGG - Exonic
1097500415 12:60393710-60393732 CTGTCCCCCAGGCTGGAGTGCGG + Intergenic
1098482709 12:70984315-70984337 CTCTCAACCAGTGTGGGGTTTGG + Intergenic
1100377225 12:94028816-94028838 CTCTCCCCAAGACTGGGATGGGG - Intergenic
1100831321 12:98518916-98518938 CTGTCGCCCAGTCTGGGGTGCGG + Intronic
1102341368 12:112124627-112124649 CTGTCCCCCAGGCTGGAGTGCGG + Intergenic
1102955489 12:117055955-117055977 CTCTCGCCCAGGCTGGAGTGCGG + Intronic
1103145144 12:118589194-118589216 CTCTAACCCAGCCTGGGGTGTGG - Intergenic
1103398980 12:120629660-120629682 CTGTCCCCCAGGCTGGAGTGCGG + Intergenic
1103545735 12:121699957-121699979 CTCTCACCCAGGCTGGAGTGCGG + Intergenic
1103775182 12:123362101-123362123 CTCTCGCCCAGGCTGGAGTGCGG - Intronic
1103804263 12:123560184-123560206 CTGTCTCCCAGGCTGGGGTGTGG + Intergenic
1103809123 12:123600032-123600054 CTGTCACCCAGGGTGGAGTGCGG + Intergenic
1104921522 12:132293086-132293108 CTCGGCCCCACTGTGGGGTGAGG - Intronic
1104947811 12:132424666-132424688 ACCTCTCCCAGCTTGGGGTGGGG + Intergenic
1105002320 12:132698661-132698683 CTCTCGCCCAGGCTGGAGTGTGG + Intronic
1105677770 13:22691760-22691782 CTGTCCCCCAGGCTGGAGTGTGG - Intergenic
1106157223 13:27170955-27170977 CTTTCCCCCAGCGCGGGGTCGGG + Intronic
1107529306 13:41266570-41266592 CTGTCACCCAGGCTGGGGTGAGG - Intergenic
1107717599 13:43216159-43216181 CTGTCCCCCAGGATGGAGTGCGG - Intronic
1107769283 13:43772710-43772732 CTGTCGCCCAGGCTGGGGTGCGG - Intronic
1107856231 13:44617907-44617929 CTGTCACCCAGGGTGGAGTGCGG + Intergenic
1108661877 13:52595245-52595267 CTCCTCCCCAGTGTGGTGTGGGG + Intergenic
1109805024 13:67428514-67428536 CTCTCACCCAGGCTGGAGTGCGG + Intergenic
1109909024 13:68885880-68885902 CTCTCCCCAGGGGAGGGGTGGGG + Intergenic
1111503306 13:89154063-89154085 CTGTCTCCCAGGCTGGGGTGCGG - Intergenic
1111600277 13:90464540-90464562 CTCTCACCCAGGCTGGGGTGCGG + Intergenic
1113874384 13:113585132-113585154 CCCACCTCCAGCGTGGGGCGCGG - Intronic
1114321422 14:21549960-21549982 CTGTCACCCAGGGTGCGGTGCGG + Intergenic
1114520553 14:23332012-23332034 CTGTCCCTCAGGGTGGAGTGCGG + Intergenic
1115173476 14:30534846-30534868 CTGTCACCCAGGCTGGGGTGCGG + Intergenic
1115592390 14:34876638-34876660 CTGTCCCCCAGGCTGGAGTGCGG + Intergenic
1115612831 14:35065208-35065230 CTCTCGCCCAGGCTGGAGTGCGG + Intronic
1117068466 14:52034017-52034039 CTCTACCCAATGGTGGGGTGGGG - Intronic
1117974553 14:61284205-61284227 CTTTCTCCCAGCCTGAGGTGCGG - Intronic
1118975933 14:70676753-70676775 CTGTCGCCCAGGGTGGAGTGTGG + Intergenic
1119650234 14:76377866-76377888 CTCTGCCCCAGGGTGGAGTGGGG - Intronic
1120740661 14:88105876-88105898 CACTCCTCCTGGGTGGGGTGGGG - Intergenic
1120834458 14:89027468-89027490 GTCTCCGCCAGCGGGCGGTGCGG - Intergenic
1121539026 14:94711269-94711291 CAGTCCCCCAGAGTGGGGTGGGG - Intergenic
1121733121 14:96200096-96200118 CTGTCCCCCAGGCTGGAGTGCGG - Intergenic
1122013090 14:98769849-98769871 CTGTCACCCAGCCTGGAGTGCGG + Intergenic
1122277904 14:100604604-100604626 CTGTGCCCCAGGGTGAGGTGGGG - Intergenic
1122353661 14:101111390-101111412 CCCTTCCCCAGGGTGGGCTGGGG - Intergenic
1122773627 14:104107806-104107828 CTGTGCCCCTGCGTGGGGGGCGG + Intronic
1122888684 14:104722949-104722971 CTCTCCCCCAGGCTGGGGCACGG + Intergenic
1124364378 15:29061916-29061938 CCCTCCATCAGCGTGTGGTGGGG + Intronic
1125029178 15:35059509-35059531 CTGTCCCCCAGGCTGGAGTGCGG + Intergenic
1125085486 15:35724760-35724782 TTCTCTGCCAGAGTGGGGTGTGG + Intergenic
1125134754 15:36328626-36328648 CTCTCACCCAGGGAGTGGTGAGG + Intergenic
1125345547 15:38715297-38715319 CTCTCACCCAGGCTGGAGTGTGG + Intergenic
1125607272 15:40947662-40947684 CTCTCCCCGAGCCTGTGGAGTGG + Intergenic
1126637928 15:50797273-50797295 CTCTCACCCAGGCTGGAGTGGGG - Intergenic
1126688447 15:51267939-51267961 TTCTTCCCCAGGGTGGGGAGGGG - Intronic
1127647723 15:60974767-60974789 CTCCACCCCAGCGTGGGGCAAGG + Intronic
1127748680 15:62008192-62008214 CTGTCACCCAGGCTGGGGTGCGG - Intronic
1128005498 15:64236104-64236126 CTGTCGCCCAGGCTGGGGTGTGG - Intronic
1129167573 15:73787453-73787475 CTCTGCCCCAGCCTGGCCTGGGG - Intergenic
1129701230 15:77769660-77769682 CTGTCCCCCAGGGGTGGGTGGGG - Intronic
1130407639 15:83616287-83616309 CTGTCCCCCAGGCTGGAGTGCGG + Intronic
1130949340 15:88573274-88573296 CTGTCACCCAGGCTGGGGTGCGG + Intergenic
1131098213 15:89669371-89669393 CTCTCTTCCAACGTGGGCTGGGG - Intronic
1131831985 15:96360242-96360264 CGCTGCCCCAGCCTGGGGTGCGG - Intergenic
1132186461 15:99806086-99806108 CTGTCCCCCAGGCTGGAGTGCGG + Intergenic
1132224565 15:100130325-100130347 CTGTCCCCCAGGCTGGAGTGCGG - Intronic
1132689108 16:1174593-1174615 CTCTGCCCCTGCTTGGGGAGGGG - Intronic
1132832023 16:1933093-1933115 CCCTCCCCCAGCATGTGCTGTGG - Intergenic
1132970887 16:2688285-2688307 CTGTCCCCCAGGCTGGAGTGTGG + Intronic
1133037041 16:3039324-3039346 CTCTCCCCCAGGCTGGAGTGCGG + Intergenic
1133163509 16:3928700-3928722 CTGTCCCCCAGGCTGGAGTGCGG - Intergenic
1135450204 16:22550925-22550947 CTATCACCCAGGGTGGAGTGGGG - Intergenic
1135677911 16:24432874-24432896 CTCTCCCCTAGGTTGGAGTGCGG + Intergenic
1135709991 16:24708275-24708297 CTGTCGCCCAGGCTGGGGTGCGG + Intergenic
1136487481 16:30582741-30582763 CCCTTCCCCTGCGTGGAGTGTGG - Exonic
1136617220 16:31405677-31405699 CTGTCTCCCAGGCTGGGGTGCGG + Intronic
1137040513 16:35607979-35608001 CTATCACCCAGGCTGGGGTGAGG + Intergenic
1137286321 16:47018792-47018814 CTGTCACCCAGCCTGGAGTGCGG - Intergenic
1137565319 16:49529058-49529080 CTCCACCCCAGCGTGGGGACTGG + Intronic
1137567505 16:49542709-49542731 CTCCTCCCCAGGGTGGGCTGGGG - Intronic
1137822907 16:51462786-51462808 CTGTCACCCAGCCTGGAGTGCGG + Intergenic
1138562356 16:57809330-57809352 CTCTCACCCAGGCTGGAGTGAGG + Intronic
1138868411 16:60851060-60851082 CTCTCCCCCAGCCTGAACTGAGG + Intergenic
1139637506 16:68266969-68266991 CTGTCACCCAGGCTGGGGTGTGG + Intronic
1139740319 16:69030069-69030091 CTGTCGCCCAGGCTGGGGTGCGG - Intronic
1139973328 16:70790072-70790094 CTCTCTGCCAGCGTGGGAAGAGG + Intronic
1141045215 16:80709962-80709984 CTTTCGCCCAGCCTGGAGTGCGG + Intronic
1141137987 16:81478949-81478971 CTCTCACCCTGCTTCGGGTGAGG - Intronic
1141479650 16:84297935-84297957 GTCTCACTCAGCGTAGGGTGAGG - Intronic
1141963210 16:87423345-87423367 CTCTCGCCCAGGCTGGGTTGTGG - Intronic
1142117811 16:88369220-88369242 TTATTCCCCAGCGTGGGGTGGGG - Intergenic
1142177117 16:88650514-88650536 CTCTCCCTGGGCTTGGGGTGGGG - Intronic
1142214596 16:88824427-88824449 GTCGCCTCCAGCCTGGGGTGTGG + Intronic
1142369841 16:89672817-89672839 CTCTCCCCCATCGTGGAATCAGG - Intergenic
1142622752 17:1175373-1175395 CTCTCGCCCAGGCTGGAGTGCGG - Intronic
1142626196 17:1193718-1193740 CTGTCCCCCAGGCTGGAGTGTGG + Intronic
1142638428 17:1271443-1271465 CTCTGCCCCAGGCTGGGATGTGG - Exonic
1142861962 17:2767767-2767789 CTCTCTCCCAGGCTGGAGTGCGG + Intergenic
1142914360 17:3123682-3123704 CTGTCACCCAGGCTGGGGTGCGG - Intergenic
1143335384 17:6168180-6168202 CTCTCACCCAGGCTGGAGTGCGG - Intergenic
1143643941 17:8217465-8217487 CTGTCCCCCAGGGTGGAGTGCGG + Intergenic
1144186091 17:12796631-12796653 CTGTCACCCAGCCTGGAGTGCGG + Intronic
1144505207 17:15823302-15823324 TTCTCCCCCAGTTTGGGCTGGGG - Intergenic
1144790628 17:17856634-17856656 CTCTCCCTCCAGGTGGGGTGGGG - Intronic
1145096766 17:20035867-20035889 CTCTCACCCAGGCTGGAGTGCGG + Intronic
1145169381 17:20641184-20641206 TTCTCCCCCAGTTTGGGCTGGGG - Intergenic
1145212867 17:21027929-21027951 CTGTCACCCAGGGTGGAGTGCGG - Intronic
1145273948 17:21418964-21418986 CTCTCCCGCAGGGTGGGGGCTGG - Exonic
1145945438 17:28770605-28770627 CTCTCACCCAGGCTGGAGTGCGG + Intronic
1145963258 17:28899948-28899970 CTGTCCCCCAGGCTGGAGTGCGG + Intronic
1146056843 17:29585549-29585571 CTTTCCCCCAGCCTGGGGGAGGG + Intronic
1146346807 17:32065531-32065553 CTGTCCCCCAGGCTGGAGTGTGG + Intergenic
1146983153 17:37185267-37185289 CTCTCGCCCAGGCTGGAGTGTGG + Intronic
1147047657 17:37766598-37766620 CTGTCCCCCAGGCTGGAGTGAGG + Intergenic
1147890591 17:43713966-43713988 CTCTCTCCCGGCGCGGGGGGCGG + Intergenic
1148920157 17:51024221-51024243 CTATCCCCCAGGCTGGAGTGCGG - Intronic
1149614538 17:57987662-57987684 CGGTCCCCCACGGTGGGGTGAGG - Intronic
1149755501 17:59182426-59182448 CTCTCACCCAGACTGGAGTGCGG + Intronic
1150359679 17:64520494-64520516 CTGTCACCCAGGGTGGAGTGCGG + Intronic
1150389828 17:64783837-64783859 ATCACCCCCAGGGAGGGGTGGGG + Intergenic
1150468643 17:65416932-65416954 CTCTCCTTCTGCGGGGGGTGAGG - Intergenic
1150766091 17:68003406-68003428 CTGTCCCCCAGGCTGGAGTGCGG + Intergenic
1151167779 17:72219780-72219802 GTCTCTCCCAGAGGGGGGTGGGG + Intergenic
1151307307 17:73271528-73271550 CTCTCACCCAGGCTGGAGTGTGG + Intergenic
1151472325 17:74326113-74326135 CTCACCCTCAGCGCGGGGAGGGG + Intergenic
1151709780 17:75797270-75797292 CTGTCCCCCAGGCTGGAGTGCGG + Intronic
1151728579 17:75898132-75898154 CTCCTCCCAAGCATGGGGTGGGG + Intergenic
1151913891 17:77103476-77103498 CTGCCCTCCAGCCTGGGGTGAGG - Intronic
1151972736 17:77467259-77467281 CCCTGCCTCAGCGTGGGGAGTGG + Intronic
1152693090 17:81730020-81730042 CTGTCACCCAGGCTGGGGTGCGG - Intergenic
1152812191 17:82387215-82387237 CCCAGCCCCAGCGTAGGGTGGGG - Intergenic
1152850014 17:82628027-82628049 CTCTCGCCCAGGCTGGAGTGCGG + Intronic
1154023367 18:10684499-10684521 CTGTCGCCCAGGCTGGGGTGCGG + Intronic
1154109770 18:11557385-11557407 CTGTCCCCCAGGCTGGAGTGCGG + Intergenic
1154214837 18:12408227-12408249 CTCTCCCCCGGCGTGCGCAGGGG + Intronic
1155925499 18:31651386-31651408 GACTCCACCAGGGTGGGGTGGGG + Intronic
1155976499 18:32137487-32137509 CTGTCACCCAGGGTGGAGTGCGG + Intronic
1156352836 18:36315722-36315744 CTCTCCCCCAGCCTGGTGCAAGG - Intronic
1157563544 18:48664568-48664590 CTCTTACCCAGGGTGGGGTGGGG + Intronic
1157764230 18:50285295-50285317 CAGCCCCCCAGGGTGGGGTGGGG - Intronic
1157816267 18:50731266-50731288 CTCTGCAGAAGCGTGGGGTGGGG + Exonic
1158672436 18:59488753-59488775 CACTCCACAAGCTTGGGGTGAGG + Intronic
1159956770 18:74524200-74524222 GTGTCCCCCAGCGAGGGGAGGGG - Intergenic
1160115945 18:76079883-76079905 CTGTCCCCCAGACTGGAGTGCGG + Intergenic
1160498055 18:79386650-79386672 CTCTGCCCCTGCGTGGGCTATGG + Intergenic
1160611336 18:80089214-80089236 CTGTCACCCAGGGTGGAGTGCGG + Intronic
1160867704 19:1263001-1263023 CTCTCCCCCAGGGCTGAGTGTGG - Intronic
1160925638 19:1543754-1543776 CTGTCGCCCAGGCTGGGGTGCGG - Intergenic
1161008818 19:1950174-1950196 CTGTCCCCCAGGCTGGAGTGTGG + Intronic
1161104062 19:2434598-2434620 CTCTGCCCCAGTCTGTGGTGAGG - Intronic
1161337375 19:3721809-3721831 CCCTCCCCCAGCCCGGGGTGGGG + Exonic
1161453691 19:4360092-4360114 GTCTCCCCAAGGCTGGGGTGAGG + Intergenic
1162159284 19:8699380-8699402 CCATCCCCCAGCCTGGAGTGCGG - Intergenic
1162325758 19:9998138-9998160 CTCTCCAGCACCCTGGGGTGGGG + Exonic
1162328146 19:10010670-10010692 TTCTCCTCCACAGTGGGGTGGGG - Intergenic
1162519257 19:11169762-11169784 CTGTCGCCCAGGGTGGAGTGCGG - Intronic
1162780962 19:13006878-13006900 CTCTGCCCGGGCATGGGGTGGGG - Intronic
1163100478 19:15092960-15092982 CTATCCCCCAGGCTGGAGTGCGG - Intergenic
1163103950 19:15112939-15112961 CTCTAGCCCAGGCTGGGGTGTGG + Intronic
1163306487 19:16482879-16482901 CTCTCACCCAGGCTGGAGTGCGG + Intronic
1163331665 19:16642511-16642533 CTCTCGCCCAGGCTGGAGTGCGG - Intronic
1163633846 19:18429583-18429605 CACTCCCCGAGGGTGGGGAGGGG - Intronic
1163771018 19:19191453-19191475 CTGTCGCCCAGGCTGGGGTGCGG - Intronic
1163867303 19:19784957-19784979 CTCTCAACCATTGTGGGGTGGGG + Intergenic
1164008265 19:21172389-21172411 CTCTCACCCAGGCTGGAGTGTGG - Intronic
1164121772 19:22272310-22272332 CTCTCAACCACTGTGGGGTGGGG + Intergenic
1164470301 19:28524626-28524648 TCGTCCCCCAGTGTGGGGTGGGG - Intergenic
1164531983 19:29055769-29055791 CTGTACTCCAGCGTGGGCTGAGG - Intergenic
1164653440 19:29902234-29902256 CTCTCGCCCAACCTGGAGTGCGG + Intergenic
1165135260 19:33663831-33663853 CTCTCACCCAGGCTGGAGTGCGG - Intronic
1165196328 19:34106776-34106798 CTGTCACCCAGCCTGGAGTGCGG - Intergenic
1165200148 19:34136838-34136860 CTGTCCCCCAGGCTGGAGTGCGG - Intergenic
1165662127 19:37590378-37590400 CTGTCCCCCAGGCTGGAGTGCGG - Intronic
1165776370 19:38406746-38406768 CTGTCACCCAGCCTGGAGTGTGG - Intronic
1165844943 19:38812326-38812348 CTCTCCACCAGGGTGGGGTAAGG + Intronic
1166320899 19:42018285-42018307 CTGTCGCCCAGCGTGGAGTGTGG - Intronic
1166647343 19:44541990-44542012 CTGTCGCCCAGGGTGGAGTGCGG - Intergenic
1167021324 19:46878355-46878377 CTGTCACCCAGGCTGGGGTGCGG + Intergenic
1167075709 19:47247563-47247585 CTCTCCACCAGGGGGCGGTGCGG - Intergenic
1167199124 19:48051914-48051936 CTGTCGCCCAGCCTGGAGTGGGG + Intronic
1167398180 19:49245469-49245491 CTGTCACCCAGCCTGGAGTGCGG + Intergenic
1167487641 19:49772530-49772552 CTGTCCCCCAGGCTGGAGTGCGG + Intronic
1167591824 19:50408422-50408444 CTGTCACCCAGGGTGGAGTGCGG + Intronic
1167687753 19:50967314-50967336 CTCTCCCTCAGCCTGGGCAGAGG - Exonic
1167883371 19:52480857-52480879 CTGTCACCCAGACTGGGGTGCGG - Intronic
1168031985 19:53687469-53687491 CTCTCGCCCAGGCTGGAGTGTGG - Intergenic
1168494225 19:56836931-56836953 CTCTCACCCAGGCTGGAGTGTGG - Intronic
1168695502 19:58401714-58401736 CTCGTCCCCGGCGTGGCGTGGGG - Intronic
925630203 2:5884212-5884234 CACTCCTCCAGCGTGAGGAGTGG - Intergenic
925858969 2:8156782-8156804 CTCTTCCCCACCATGGGGTCAGG + Intergenic
925959888 2:9004195-9004217 GTCTCTCCCAGAGAGGGGTGGGG - Intergenic
926354828 2:12032093-12032115 ATCGCCCTCAGAGTGGGGTGGGG + Intergenic
926997594 2:18753602-18753624 CTCTCACCCAGGCTGGTGTGTGG + Intergenic
927464269 2:23325325-23325347 CTGTCCCCCAGGCTGGAGTGTGG - Intergenic
929102360 2:38327897-38327919 CTCTCACCCAGGCTGGAGTGCGG - Intronic
929339015 2:40789884-40789906 CTGTCGCCCAGGGTGGAGTGCGG - Intergenic
929469732 2:42179637-42179659 CTGTCGCCCAGGCTGGGGTGCGG + Intronic
929502292 2:42500845-42500867 CTCTCGCCCAGGCTGGAGTGTGG + Intronic
929516921 2:42611776-42611798 CTGTCCCCCAGGCTAGGGTGTGG - Intronic
930061916 2:47296841-47296863 CTCTCGCCCAGGCTGGAGTGCGG - Intergenic
930551002 2:52834939-52834961 CTCTCTCCCAGGCTGGAGTGCGG + Intergenic
931443005 2:62304557-62304579 CTTTCCTCCAGCCTGAGGTGAGG + Intergenic
932178741 2:69626534-69626556 CTGTCTCCCAGCCTGGAGTGAGG + Intronic
933132625 2:78691256-78691278 CTTTCACCCAGGCTGGGGTGCGG - Intergenic
933780873 2:85799957-85799979 CTCTAGACCAGCTTGGGGTGGGG + Intergenic
934174948 2:89570509-89570531 CTGTCGCCCAGCCTGGAGTGCGG + Intergenic
934285264 2:91644859-91644881 CTGTCGCCCAGCCTGGAGTGCGG + Intergenic
934748568 2:96776648-96776670 CTCTCGCCCAGCCTGGAGTGCGG + Intronic
935090708 2:99892537-99892559 CTGTCTCCCAGGATGGGGTGGGG + Intronic
935251543 2:101266249-101266271 GTCTCCACCTGGGTGGGGTGGGG + Intronic
936564535 2:113572761-113572783 CTGTCACCCAGCCTGGAGTGCGG - Intergenic
937044236 2:118842860-118842882 TTCTCCCCCAGCGAGGGGCCGGG + Exonic
937118344 2:119425439-119425461 CTGTACCCCATCGTGTGGTGGGG + Intergenic
937407328 2:121642361-121642383 CTGTCACCCAGGGTGGAGTGTGG - Intronic
937782413 2:125854234-125854256 CATTCCCCCAGTATGGGGTGAGG + Intergenic
937908332 2:127063521-127063543 CCCTCGGCCAGGGTGGGGTGTGG + Intronic
937954936 2:127416831-127416853 CTGTCTCCCAACCTGGGGTGGGG + Intergenic
938307586 2:130265840-130265862 CTCTGTCCCAGCCTGGGGCGGGG - Intergenic
938447746 2:131391002-131391024 CTCTGTCCCAGCCTGGGGCGGGG + Intergenic
938846951 2:135219906-135219928 CTGTCACCCAGGCTGGGGTGCGG + Intronic
940136595 2:150443306-150443328 CTGTCCCCCAGGCTGGAGTGCGG - Intergenic
940637966 2:156320766-156320788 AGCGCCCCCAGCGTGGGGTGGGG + Intergenic
940656673 2:156495311-156495333 CTGTTGCCCAGCCTGGGGTGCGG - Intronic
940912021 2:159217399-159217421 CTCTCCCCCAGTGGGAGATGGGG - Intronic
941169226 2:162117520-162117542 CTGTTGCCCAGCCTGGGGTGTGG + Intergenic
942892198 2:181004594-181004616 CTCTTCGCCAGACTGGGGTGCGG - Intronic
944560509 2:200932374-200932396 CTGTCACCCAGCCTGGAGTGTGG + Intronic
944649002 2:201810017-201810039 CTCTCACCCAGGCTGGAGTGCGG - Intronic
945925728 2:215801682-215801704 CTGTCACCCAGGGTGGAGTGTGG - Intergenic
946743943 2:222827443-222827465 CTGTCACCCAGCCTGGAGTGTGG - Intergenic
948024365 2:234765101-234765123 TTCTCCCCCAGCCCTGGGTGGGG - Intergenic
948048570 2:234962171-234962193 CTCTCACCCAGACTGGAGTGCGG + Intronic
948112084 2:235464260-235464282 CTCTCTCCCACGGTGGGGTTTGG + Intergenic
948145257 2:235703633-235703655 CTATCCCCCAGGCTGGAGTGCGG + Intronic
948438977 2:237974028-237974050 CTCTCACCCAGGCTGGAGTGCGG + Intronic
948592991 2:239063235-239063257 CTCTCGCCCAGGCTGGAGTGTGG + Intronic
948664266 2:239525075-239525097 CTCTCACCCAGGCTGGAGTGCGG + Intergenic
1169022598 20:2340740-2340762 CTCTCCCCCAGGTTGGGGCTGGG + Exonic
1169246483 20:4029217-4029239 CTGTCGCCCAGGCTGGGGTGCGG + Intergenic
1169288663 20:4330621-4330643 CTGTCCCCCAGGCTGGAGTGCGG + Intergenic
1169471685 20:5891466-5891488 CTCTAGCCCAGCCTGGAGTGCGG + Intergenic
1169905324 20:10597269-10597291 AGCTCCACCAGAGTGGGGTGAGG - Intronic
1170208298 20:13823048-13823070 CTCTCGCCCAGGCTGGAGTGCGG + Intergenic
1170292732 20:14788803-14788825 CTGTCCCCCAGGCTGGAGTGCGG + Intronic
1171972315 20:31572101-31572123 CTGTCCCCCAGGCTGGAGTGCGG - Intronic
1172242812 20:33424548-33424570 CTCTCACCCAGGCTGGAGTGCGG + Intronic
1172411829 20:34730102-34730124 CTGTCCCCCAGGCTGGGGTGTGG + Intronic
1172811703 20:37652775-37652797 CTCTCGCCCAGGCTGTGGTGCGG + Intergenic
1173342050 20:42161605-42161627 GTCTCCCCCAGCTTGGCCTGAGG + Intronic
1174494003 20:50926061-50926083 CTGTCTCCCAGGCTGGGGTGCGG - Intronic
1174829921 20:53803313-53803335 CTGTCCCCCAGGCTGGAGTGCGG + Intergenic
1175868477 20:62194761-62194783 GTCCTCCCCAGCGTGTGGTGAGG + Intronic
1176101043 20:63364752-63364774 GTGTCCCCCAGGGTGGGGGGCGG - Intronic
1176207796 20:63899616-63899638 CTCTCACCCAGGCTGGAGTGCGG + Intronic
1177072407 21:16527264-16527286 CTGTCGCCCAGGGTGGAGTGCGG + Intergenic
1177348769 21:19907232-19907254 CTGTCACCCAGCCTGGAGTGCGG - Intergenic
1177958743 21:27635362-27635384 CTGTCCCCCAGGCTGGAGTGCGG + Intergenic
1178531529 21:33380366-33380388 CTGTCACCCAGGGTGGAGTGTGG - Intergenic
1178970978 21:37176549-37176571 CTCTGCACCAGTGTGGGCTGAGG - Intronic
1179659095 21:42863228-42863250 CTGTGCCCCAGCGTTTGGTGGGG - Intronic
1180073327 21:45449538-45449560 CTCTCCCCCACGGTGGGGGCAGG - Intronic
1180947012 22:19700899-19700921 CTGTCACCCAGCCTGGAGTGCGG - Intergenic
1181161834 22:20964281-20964303 CTTGCCCCCTGGGTGGGGTGGGG + Intergenic
1181497400 22:23295241-23295263 CTTGCACCCAGGGTGGGGTGGGG + Intronic
1181497837 22:23297963-23297985 CTCTTCCCCGGGATGGGGTGGGG - Intronic
1181647174 22:24238190-24238212 CTGTCCCCCAGGCTGGGGTGTGG - Intronic
1182058871 22:27382443-27382465 CTCTGACCCAGCCTGGGGTTGGG - Intergenic
1182142504 22:27973204-27973226 CTGTCACCCAGGCTGGGGTGTGG + Intergenic
1182272909 22:29166894-29166916 CTGTCACCCAGCCTGGAGTGCGG - Intronic
1182315010 22:29439907-29439929 CTCTTCCCAACCCTGGGGTGAGG - Intronic
1182377825 22:29860880-29860902 CTGTCCCCCAGGCTGGAGTGCGG + Intergenic
1182447768 22:30399475-30399497 CTCTCGCCCAGGCTGGAGTGCGG - Intronic
1182541440 22:31044941-31044963 CTGTCCCCCAGGCTGGAGTGAGG + Intergenic
1182562358 22:31170545-31170567 CTGTCACCCAGGGTGGAGTGCGG + Intronic
1183315770 22:37136136-37136158 TTCTCTCCCTGCCTGGGGTGAGG - Intronic
1183330239 22:37215911-37215933 TTCTCCACCATCGTGGTGTGTGG - Intergenic
1184494115 22:44827377-44827399 CTGTCCCCCAGGCTGGAGTGCGG + Intronic
1184595638 22:45512420-45512442 CTCTCGGCCAGGCTGGGGTGGGG - Intronic
1184656592 22:45944874-45944896 CTGTCCTCCAGTGTGGGGTGGGG - Intronic
1185305962 22:50116408-50116430 CTGTCACCCAGCCTGGAGTGCGG - Intronic
949550378 3:5107836-5107858 CTCTCACCCAGGCTGGAGTGCGG + Intergenic
950075231 3:10182317-10182339 CTGTCGCCCAGCCTGGAGTGCGG + Intronic
950296673 3:11838249-11838271 CTGTCGCCCAGGCTGGGGTGCGG + Intronic
950655921 3:14436235-14436257 CTGTCACCCAGCCTGGAGTGAGG + Intronic
951609780 3:24479263-24479285 CTGTCCCCCAGACTGGAGTGCGG - Intronic
951882341 3:27491661-27491683 CTCTCACCCAGGCTGGAGTGTGG + Intergenic
952020276 3:29010155-29010177 CTGTCGCCCAGGGTGGAGTGCGG - Intergenic
952237755 3:31497762-31497784 CTCTCACCCAGGCTGGAGTGTGG - Intergenic
952325673 3:32318601-32318623 CTGTCACCCAGCCTGGAGTGCGG + Intronic
953360174 3:42288907-42288929 CTCTTCCCCATCATGGAGTGGGG + Intergenic
953389455 3:42526055-42526077 ATCTCTCCCACCGAGGGGTGTGG + Intronic
954056958 3:48034664-48034686 CTGTCGCCCAGGGTGGAGTGTGG - Intronic
954118397 3:48479938-48479960 CTCTCGCCCAGGCTGGAGTGCGG + Intronic
954336658 3:49922443-49922465 CTGTCACCCAGGGTGGAGTGTGG - Intronic
954437547 3:50503902-50503924 CTCTTCCCGCGGGTGGGGTGGGG - Intronic
954654899 3:52188339-52188361 CTCTCCCCCAGGATGGAGTGTGG - Intergenic
954883817 3:53854735-53854757 TTCTACCCCACCCTGGGGTGAGG + Intronic
954973384 3:54670770-54670792 CACACCCTCAGCCTGGGGTGTGG + Intronic
955204401 3:56882548-56882570 CTGTCGCCCAGGCTGGGGTGCGG + Intronic
955273645 3:57526868-57526890 CTGTCACCCAGGTTGGGGTGTGG + Intronic
956289942 3:67650718-67650740 CTCTCACCCAGGCTGGAGTGCGG - Intronic
957203609 3:77166593-77166615 CTGTCGCCCAGGCTGGGGTGCGG + Intronic
959874475 3:111365791-111365813 CTCTCACCCAGGCTGGAGTGCGG + Intronic
960047034 3:113208957-113208979 CTCTCACCCAGGCTGGAGTGCGG - Intergenic
960969088 3:123126337-123126359 CTCTCCCACAGCGGGGGATGGGG - Intronic
961139433 3:124543336-124543358 CTGTCCCCCAGGCTGGAGTGCGG + Intronic
961626300 3:128266274-128266296 CTCTCACCCAGCGGGTGATGTGG - Intronic
962240679 3:133748359-133748381 CTCTCCCTCAGCATAGGGAGTGG + Intronic
963155149 3:142088365-142088387 CTATCCCCCAGGCTGGAGTGCGG + Intronic
963249728 3:143092057-143092079 CTGTCACCCAGGCTGGGGTGTGG - Intergenic
963274232 3:143314366-143314388 CTGTCCCACAGAGTGGGGTAAGG + Intronic
963321249 3:143811823-143811845 CTGTCACCCAGCCTGGAGTGTGG - Intronic
964791106 3:160453564-160453586 CTCTCCCCCAGCCTGCCATGTGG + Intronic
964960723 3:162420922-162420944 CTGTCACCCAGCCTGGAGTGCGG - Intergenic
965487142 3:169292294-169292316 CTGTCACCCAGGCTGGGGTGTGG - Intronic
965701220 3:171460567-171460589 CTCTGCACCAGCGTGGAGGGGGG + Intergenic
966456114 3:180118009-180118031 CTCTCCGCCACAGTGTGGTGTGG + Intergenic
966456124 3:180118054-180118076 CTCTCCCCCACAGCGTGGTGTGG + Intergenic
966456136 3:180118099-180118121 CTCTCCCCCACAGCGTGGTGTGG + Intergenic
966456147 3:180118144-180118166 CTCTCCCCCACAGCGTGGTGTGG + Intergenic
966522916 3:180893099-180893121 CTGTCACCCAGTGTGGAGTGCGG + Intronic
966974649 3:185073368-185073390 TTCTGCCCCAGCTAGGGGTGTGG + Intergenic
967182973 3:186922434-186922456 CGCTTCCCAAGCTTGGGGTGGGG + Intergenic
967644593 3:191906296-191906318 CTCTCACCCAGACTGGAGTGCGG - Intergenic
967721936 3:192825176-192825198 CTGTCGCCCAGGCTGGGGTGCGG + Intronic
968092375 3:195907436-195907458 CTCTGCCCCAGCCCGAGGTGTGG - Intronic
968288352 3:197521142-197521164 CTTTCCCTCAGAATGGGGTGGGG - Intronic
968497778 4:927790-927812 CGCTCACCCAGGGAGGGGTGCGG - Intronic
968497789 4:927819-927841 CGCTCACCCAGGGAGGGGTGCGG - Intronic
968704676 4:2072358-2072380 CTGTCCCCCTGCTTGGGGTCTGG - Intronic
968719703 4:2192385-2192407 CTGTCCCCCAGGCTGGAGTGCGG + Intronic
969469661 4:7380162-7380184 CTCAGCCCCAGCCTGGGGTTTGG + Intronic
971021121 4:22536783-22536805 CTGTCCCCCAGGTTGGAGTGCGG + Intergenic
971791458 4:31175045-31175067 CTGTCCCCCAGGCTGGAGTGGGG + Intergenic
971906470 4:32732547-32732569 CTGAGCCCCTGCGTGGGGTGGGG + Intergenic
972504441 4:39707247-39707269 CTCTCACCCAGGCTGGAGTGCGG + Intronic
972507892 4:39738712-39738734 CTGTCACCCAGCCTGGAGTGCGG + Intronic
973338385 4:48979344-48979366 CTGTCGCCCAGAGTAGGGTGCGG - Intergenic
974757820 4:66234274-66234296 GTCTCCCCCAGGCTGGAGTGCGG - Intergenic
974854658 4:67446035-67446057 CTCTCGCCCAGCGAGGGGAAAGG - Intergenic
975037592 4:69703730-69703752 CTCTCGCCCAGGCTGGAGTGCGG - Intergenic
976304452 4:83546019-83546041 CTGTCCCCCAGGCTGGAGTGCGG + Intronic
977240228 4:94559714-94559736 CTCACCCACAGCCTTGGGTGTGG + Intronic
977255399 4:94734985-94735007 CTGTCCCCCAGGCTGGAGTGTGG + Intergenic
977568789 4:98609350-98609372 CTCTCCCCCAGCCAGTGGTCGGG - Intronic
978132408 4:105214574-105214596 ATCTCCCTCAGGGTTGGGTGTGG - Intronic
979106482 4:116695660-116695682 CTATCCCCCAGGCTGGAGTGCGG + Intergenic
979658160 4:123221190-123221212 CTGTCACCCAGGCTGGGGTGCGG + Intronic
980092355 4:128455778-128455800 CTGTCCCCCAGCCTGGGCTATGG + Intergenic
980109115 4:128617677-128617699 CTGTCCCCCAGGCTGGAGTGCGG - Intergenic
981421391 4:144554496-144554518 CTCTCGCCCAGGCTGGAGTGCGG + Intergenic
982235465 4:153248030-153248052 CTGTCCCCCAGGCTGGAGTGCGG + Intronic
982263257 4:153514847-153514869 CTGTCCCCCAGGCTGGAGTGTGG + Intronic
982736748 4:159014414-159014436 CTTTCGCCCAGCCTGGAGTGCGG - Intronic
984702138 4:182825356-182825378 ATTTCCCCCAGTGTGGGGTTGGG + Intergenic
985632341 5:1020592-1020614 CTCTCTCCAAGCGTGGGGAGAGG + Intronic
985909161 5:2865568-2865590 CTGTCACCCAGCCTGGAGTGCGG + Intergenic
986175147 5:5345991-5346013 CTGTCCCCCAGGCTGGAGTGCGG - Intergenic
986692175 5:10322121-10322143 CTGTCCCCCAGGCTGGAGTGCGG + Intergenic
986693509 5:10333038-10333060 CTCTCTCCCCGCGTGTGATGGGG + Intergenic
988464837 5:31478695-31478717 TTCTCACCCAGGGTGGAGTGCGG - Intronic
988779120 5:34503082-34503104 CTGTCCCCAAGCTTGGAGTGGGG - Intergenic
989041045 5:37229500-37229522 CTGTCCCCCAGGCTGGAGTGCGG - Intronic
989380368 5:40804315-40804337 CTCTCACCCAGGCTGGAGTGCGG - Intergenic
989519167 5:42380906-42380928 CTGTCGCCCAGCCTGGAGTGCGG + Intergenic
989794475 5:45449872-45449894 CTGTCCCCCAGGCTGGAGTGCGG + Intronic
990217771 5:53552958-53552980 TCCTCCCCCTGCTTGGGGTGGGG + Intergenic
990571157 5:57080101-57080123 CTGTCCCCCAGGCTGGTGTGTGG - Intergenic
991060072 5:62365054-62365076 CTGTCACCCAGGCTGGGGTGTGG - Intronic
991135787 5:63180320-63180342 CTGTCACCCAGGCTGGGGTGCGG - Intergenic
992315304 5:75546700-75546722 CTGTCCCCCAGGCTGGAGTGCGG + Intronic
992690170 5:79234290-79234312 CTGTCCCCCAGGCTGGAGTGCGG + Intronic
993071282 5:83166916-83166938 CTGTCACCCAGACTGGGGTGCGG + Intronic
993831014 5:92758091-92758113 CTGTCCCCCAGGCTGGAGTGAGG + Intergenic
997515725 5:134488279-134488301 CTGTCGCCCAGCCTGGAGTGCGG + Intergenic
998131701 5:139654794-139654816 CTCACCCCAAGCCTAGGGTGGGG + Intronic
998267438 5:140676798-140676820 CTCTTCCCCTGCCTGGGCTGGGG + Exonic
998482588 5:142475091-142475113 CTTGCCCCCAGCATGGTGTGGGG - Intergenic
998838295 5:146225897-146225919 CTGTCACCCAGGGTGGAGTGCGG + Intronic
999224601 5:150010561-150010583 CTCTCCCCAACCTGGGGGTGGGG - Exonic
999745757 5:154590577-154590599 CTTGCCCCCAGTGTGGGGTCTGG + Intergenic
999765641 5:154738553-154738575 CTGTCCCCCAGTCTGGAGTGCGG - Intronic
1000074860 5:157775402-157775424 CTGTCACCCAGCCTGGAGTGCGG - Intergenic
1000389517 5:160708575-160708597 CTGTCCAGCAGTGTGGGGTGGGG + Intronic
1001035363 5:168292658-168292680 CTTCCACCCAGCGTGGGGGGTGG + Intronic
1001430803 5:171660509-171660531 CTCTCACCCCATGTGGGGTGCGG + Intergenic
1002284448 5:178153049-178153071 CTCTCACCCAGGTTGGAGTGCGG - Intronic
1002603638 5:180369565-180369587 TTCACACCCATCGTGGGGTGGGG + Intergenic
1003219022 6:4140681-4140703 CTCTCTCCCAGGCTGGAGTGCGG + Intergenic
1003997649 6:11559228-11559250 CTGTCACCCAGGCTGGGGTGTGG + Intronic
1004089152 6:12482060-12482082 ATCTTCCCCAGTGAGGGGTGGGG + Intergenic
1005031688 6:21514737-21514759 CTCTCACCCAGGCTGGAGTGCGG - Intergenic
1005050197 6:21677233-21677255 CTCTCGCCCAGGCTGGAGTGCGG + Intergenic
1005631639 6:27713635-27713657 CTCTCACCCAGGCTGGAGTGCGG - Intergenic
1006647065 6:35522224-35522246 CCTGCCCCTAGCGTGGGGTGGGG - Intergenic
1006952488 6:37835194-37835216 CTCTCTCCCAGGCTGGGGTGCGG + Intronic
1007435667 6:41808948-41808970 CTGTCACCCAGCCTGGAGTGCGG + Intronic
1007784135 6:44270609-44270631 CCCTCCCCCGGCGGGGGGTGGGG + Exonic
1008190173 6:48446750-48446772 CTGTCACCCAGCCTGGAGTGTGG + Intergenic
1008786383 6:55174217-55174239 CTCTCCCTCAGCGAGGGAGGAGG + Exonic
1009356451 6:62752896-62752918 CTGTCACCCAGGGTGGAGTGTGG - Intergenic
1010434857 6:75817266-75817288 CTCTCACCCAGGCTGGAGTGCGG - Intronic
1010759190 6:79702763-79702785 CTCAGCCCCTGGGTGGGGTGGGG + Exonic
1010762081 6:79734895-79734917 CTGTCCCCCAGGCTGGAGTGCGG - Intergenic
1011443539 6:87412693-87412715 CTGTCCCCCAAGCTGGGGTGCGG + Intronic
1013154669 6:107481905-107481927 CTCTCACCCAGGCTGGAGTGCGG + Intergenic
1013555023 6:111247734-111247756 CTGTCACCCAGGCTGGGGTGCGG - Intergenic
1013850132 6:114504255-114504277 ATCACCCCCGTCGTGGGGTGGGG - Intergenic
1014816196 6:125938616-125938638 CTGTCCCCCAGGCTGGAGTGCGG + Intergenic
1017966464 6:159271108-159271130 CCCAACCCCAGCCTGGGGTGGGG - Intronic
1018026015 6:159806393-159806415 TTTTCCCCCAGCATGTGGTGTGG + Intronic
1019014217 6:168867880-168867902 CTGACCTCCAGCCTGGGGTGTGG + Intergenic
1019029447 6:168997773-168997795 CTATCCCCCAGGCTGGAGTGAGG + Intergenic
1019460684 7:1156826-1156848 TCCTGCCCCAGCATGGGGTGGGG - Intronic
1019517098 7:1444927-1444949 GGCTCCCCCACCCTGGGGTGTGG + Exonic
1019704188 7:2489728-2489750 CTGTCACCCAGCCTGGAGTGCGG - Intergenic
1019755924 7:2769694-2769716 CTCTCACCCAGGCTGGAGTGCGG - Intronic
1019782082 7:2946769-2946791 CTGTCCCCCAGCGTGGCTGGTGG - Intronic
1019830430 7:3322844-3322866 CTGTCGCCCAGGCTGGGGTGTGG + Intronic
1019906462 7:4068756-4068778 CTCTCGCCCAGGCTGGAGTGCGG + Intronic
1020019537 7:4854655-4854677 CTGTCGCCCAGGGTGGAGTGCGG - Intronic
1020059515 7:5141866-5141888 CTGTCGCCCAGGGTGGAGTGCGG + Intergenic
1020103981 7:5412537-5412559 CTGTCTCCCAGGCTGGGGTGCGG - Intronic
1020163836 7:5793197-5793219 CTGTCACCCAGCCTGGAGTGCGG - Intergenic
1020305569 7:6831488-6831510 CTATCGCCCAGGCTGGGGTGCGG + Intergenic
1020331248 7:7019260-7019282 CTGTCACCCAGGGTGGAGTGCGG + Intergenic
1020567056 7:9810982-9811004 CTTTCCCCCAGGCTGGAGTGAGG - Intergenic
1021459563 7:20870965-20870987 CTGTCACCCAGGCTGGGGTGCGG - Intergenic
1021702823 7:23336909-23336931 CTGTCACCCAGGGTGGAGTGTGG - Intronic
1023258832 7:38338147-38338169 CTGTCCCCCAGGCTGGAGTGCGG + Intergenic
1023864705 7:44233227-44233249 CTGTGCCCCAGCGTGGTGGGGGG + Intronic
1023879859 7:44312247-44312269 ATTTCCCCCAGTGTGGGCTGAGG - Intronic
1024128812 7:46328303-46328325 CTCTCGCCCAGGCTGGAGTGCGG - Intergenic
1024632214 7:51259248-51259270 CTGTTCCCCAGCCTGGAGTGCGG - Intronic
1025185219 7:56852344-56852366 CTGTCGCCCAGGGTGGAGTGCGG - Intergenic
1025189989 7:56888929-56888951 CTGTCACCCAGGGTGGAGTGTGG - Intergenic
1025681950 7:63687992-63688014 CTGTCACCCAGGGTGGAGTGTGG + Intergenic
1025686712 7:63724615-63724637 CTGTCGCCCAGGGTGGAGTGCGG + Intergenic
1026036824 7:66836071-66836093 CTCTGCCACTGAGTGGGGTGGGG + Intergenic
1026079880 7:67208282-67208304 CTGTTCCCCAGGCTGGGGTGCGG - Intronic
1026714547 7:72776522-72776544 CTCTCACCCAGTCTGGAGTGCGG - Intronic
1026737166 7:72956305-72956327 CTATCCCCCAGGCTGGAGTGCGG - Intergenic
1026771604 7:73204691-73204713 CTGTCACCCAGGGTGGAGTGAGG + Intergenic
1027012470 7:74758087-74758109 CTGTCACCCAGGGTGGAGTGAGG + Intronic
1027075570 7:75187966-75187988 CTGTCACCCAGGGTGGAGTGAGG - Intergenic
1027106566 7:75408763-75408785 CTATCCCCCAGGCTGGAGTGCGG + Intronic
1027360633 7:77405261-77405283 CTGTCACCCAGGCTGGGGTGTGG - Intronic
1028501269 7:91521143-91521165 CTCTCCACCAGCATGGGCAGAGG - Intergenic
1029190775 7:98770581-98770603 CTGTCACCCAGGCTGGGGTGCGG - Intergenic
1029241820 7:99168545-99168567 CTGTCCCCCAGGCTGGGGTGTGG + Intergenic
1029249005 7:99222782-99222804 CTGTCCCCCAGGCTGGAGTGCGG - Intergenic
1029666517 7:101998576-101998598 CTATCGCCCTGAGTGGGGTGTGG - Intronic
1029876274 7:103755569-103755591 CTGTCCCCCAGGCTGGAGTGCGG - Intronic
1029876298 7:103755774-103755796 CTGTCCCCCAGACTGGAGTGCGG - Intronic
1032104927 7:129019957-129019979 CTCTCACCCAGGCTGGAGTGTGG - Intronic
1033186627 7:139232055-139232077 GTCGCCCCGAGGGTGGGGTGCGG + Intronic
1033222398 7:139536938-139536960 CTGTCGCCCAGGGTGGAGTGCGG - Intronic
1033632402 7:143171608-143171630 CTGTCGCCCAGGCTGGGGTGCGG - Intergenic
1033768681 7:144523630-144523652 CTCTCACCCAGGCTGGAGTGTGG - Intronic
1034146245 7:148874858-148874880 CTGTCCCCCAGGCTGGAGTGCGG - Intronic
1034444262 7:151104661-151104683 CTCTCCACCAGCCGTGGGTGGGG - Intronic
1034477321 7:151293061-151293083 CTATCTCCCAGACTGGGGTGCGG - Intergenic
1034584486 7:152077052-152077074 CTGTCACCCAGGCTGGGGTGTGG - Intronic
1034926450 7:155126315-155126337 CTCTACGCCAGTGTGAGGTGAGG - Intergenic
1035038298 7:155909441-155909463 TCCCACCCCAGCGTGGGGTGTGG - Intergenic
1035252506 7:157606334-157606356 CTCCTCCCCAGCGTGGGGGTGGG + Intronic
1035420850 7:158728338-158728360 GTCTCACCCAGCCTGGAGTGCGG + Intergenic
1035422508 7:158741454-158741476 CTCTCCCCCAGCGTGGGGTGGGG + Intronic
1035636095 8:1145380-1145402 CACTCGCCCAGCGTGGGGCCTGG + Intergenic
1036668900 8:10766586-10766608 CTTTCCCTCAGCTGGGGGTGGGG + Intronic
1036704565 8:11037260-11037282 CTCTCACCCAGGCTGGAGTGTGG + Intronic
1036751482 8:11446248-11446270 CTCAGCCCCAGCCTGTGGTGGGG + Intronic
1036932079 8:12965974-12965996 CTGTCACCCAGGCTGGGGTGCGG - Intronic
1037261020 8:17008300-17008322 CTCTCACCCAGGCTGGAGTGCGG - Intergenic
1037374581 8:18213848-18213870 CTCTCGCCCAGGCCGGGGTGCGG + Intronic
1037695837 8:21223252-21223274 CTCTCACCCAGGCTGGAGTGGGG - Intergenic
1037855354 8:22367459-22367481 CACTGCCCCAGCCTGGGGTGCGG - Intronic
1037859362 8:22393706-22393728 CTGTCACCCAGGCTGGGGTGCGG + Intronic
1038330102 8:26601412-26601434 CTGTCCCCCAGGCTGGAGTGCGG + Intronic
1038799429 8:30735800-30735822 CTGTCCCCCAGGCTGGGGTGCGG - Intronic
1038964818 8:32559978-32560000 CTGTCACCCAGCCTGGAGTGTGG - Intronic
1039005037 8:33026775-33026797 TTCTCCCTCAGGGTGAGGTGAGG + Intergenic
1039049428 8:33479376-33479398 CTGTCACCCAGGGTGGAGTGCGG - Intronic
1039576058 8:38624923-38624945 CTCTCGCCCAGGCTGGAGTGTGG - Intergenic
1039701858 8:39970426-39970448 CTGTCCCCCAGGCTGGAGTGTGG + Intronic
1042301605 8:67288694-67288716 CTGTCACCCAGGGTGGAGTGCGG - Intronic
1042758199 8:72241662-72241684 CTGTCTCCCAGGGTGGAGTGTGG - Intergenic
1043177308 8:77038135-77038157 CTGTCACCCAGGCTGGGGTGTGG - Intergenic
1044650694 8:94491275-94491297 CTGTCGCCCAGGCTGGGGTGCGG - Intronic
1044885063 8:96767977-96767999 CTCACCTCCAGCCTGGGATGTGG + Intronic
1044996527 8:97842913-97842935 CTCTCACCCAGGCTGGAGTGTGG + Intronic
1045362901 8:101449408-101449430 CTCTCCTCCATGGAGGGGTGGGG + Intergenic
1045383996 8:101653703-101653725 CTCTCTCCCAGTCTGGAGTGTGG - Intronic
1045495614 8:102705855-102705877 CTGTCGCCCAGCCTGGAGTGCGG + Intergenic
1045715030 8:105032766-105032788 CTCTCGCCCAGGCTGGAGTGCGG - Intronic
1047762031 8:127961520-127961542 TGCTCACCCAGCTTGGGGTGGGG - Intergenic
1047977528 8:130145876-130145898 CTGTCGCCCAGGGTGGGGTACGG + Intronic
1048355861 8:133653698-133653720 CTCTCATCCAGGGTGGGGTCTGG + Intergenic
1048405351 8:134113767-134113789 CTGTCCCCAAGTGTGGGGAGGGG + Intergenic
1048963736 8:139600236-139600258 CTCGCCCCCAGCCAGGGCTGAGG - Intergenic
1049302764 8:141880348-141880370 CCCTCCCCCAGTGTGTGGGGGGG + Intergenic
1049390943 8:142370529-142370551 CTGTCCCCCAGGCTGGAGTGCGG - Intronic
1049567907 8:143351541-143351563 CTGTCCCCCAGACTGGAGTGCGG - Intronic
1049608434 8:143540917-143540939 CTGTCACCCAGGCTGGGGTGCGG - Intronic
1049781606 8:144431549-144431571 CTGTCGCCCAGGGTGGAGTGCGG + Intronic
1050276963 9:4010117-4010139 ATCTCCCCCGGGGTGGGGTGAGG + Intronic
1050802523 9:9633263-9633285 CTCTCTCCCAGGCTGGAGTGTGG - Intronic
1051651683 9:19332700-19332722 CTCTCGCCCAGGCTGGAGTGCGG + Intronic
1052990129 9:34514218-34514240 CTTTCCCCCAGGGTGTGCTGAGG + Intronic
1053142264 9:35689581-35689603 CTCTCACCCAGGGTGGGGGCTGG - Intronic
1054709569 9:68497997-68498019 CTGACCACCAGAGTGGGGTGGGG - Intronic
1057055194 9:91955050-91955072 CCCTGCCCCACTGTGGGGTGAGG - Intergenic
1057360602 9:94370191-94370213 CTCTCACCCAGGCTGGAGTGTGG - Intergenic
1057490092 9:95513822-95513844 CTTTCCTCCAGCCTGGGGAGGGG - Intronic
1057662738 9:97017888-97017910 CTCTCACCCAGGCTGGAGTGTGG + Intergenic
1057913202 9:99035957-99035979 CCCTCTCCCAGCATTGGGTGAGG - Intronic
1058890327 9:109355652-109355674 CTGTCCCCCAGGCTGGGGTGTGG + Intergenic
1059297073 9:113280875-113280897 CTGTCACCCAGGGTGGAGTGCGG + Intronic
1061049485 9:128185984-128186006 TTCTGCCCCAGCTAGGGGTGGGG + Intronic
1061173073 9:128973417-128973439 CTGTCCCCCAGGCTGGAGTGTGG + Intronic
1061230773 9:129314628-129314650 CTCTCACCCAGGCTGGAGTGCGG + Intergenic
1061511502 9:131063942-131063964 CTGTCCCCCAGGCTGGAGTGCGG + Intronic
1061816298 9:133199357-133199379 CTGTCCCCCAGGCTGGAGTGCGG - Intergenic
1061967461 9:134024220-134024242 CTGTCACCCAGGGTGGAGTGTGG - Intergenic
1062176241 9:135164583-135164605 ATCTCCCTCGGCTTGGGGTGGGG - Intergenic
1062372045 9:136245168-136245190 CTATCCCCAAGCGTGCGGTGAGG + Intronic
1185452436 X:289992-290014 CTCTCACCCAGACTGGAGTGCGG + Intronic
1185768559 X:2747137-2747159 CTGTCCCCCAGGCTGGAGTGCGG + Intergenic
1185886570 X:3788820-3788842 CTCTCCTTCTGCTTGGGGTGAGG - Intergenic
1185958751 X:4523039-4523061 CTGTCGCCCAGCCTGGAGTGCGG + Intergenic
1186128404 X:6440784-6440806 CTATCACCCAGGGTGGAGTGTGG - Intergenic
1186211477 X:7254616-7254638 CTGTCGCCCAGCCTGGAGTGTGG + Intronic
1186363361 X:8866094-8866116 CTGTCCCCCAGGTTGGAGTGTGG + Intergenic
1187173295 X:16871224-16871246 AGCTCCGCCAGCTTGGGGTGGGG - Intergenic
1187455081 X:19434260-19434282 CTGTCACCCAGCCTGGAGTGTGG + Intronic
1187532265 X:20107532-20107554 CTATCCCCCAGGCTGGAGTGCGG - Intronic
1190214449 X:48470326-48470348 CCCACCCCAAGCGTGGGGTGGGG + Intergenic
1190529805 X:51362820-51362842 CTCTCACCCAGGCTGGAGTGGGG - Intergenic
1192234931 X:69289724-69289746 CTCTCCCCCAGCCTGGGGGAGGG - Intergenic
1192313121 X:70032644-70032666 CTCCACCCCTGCCTGGGGTGGGG + Intronic
1194478675 X:94392290-94392312 CTGTCACCCAGCCTGGAGTGTGG - Intergenic
1194977851 X:100411086-100411108 TTCTCCAACAGGGTGGGGTGAGG - Intergenic
1195031011 X:100927911-100927933 CTCTGCCCAAGTCTGGGGTGGGG + Intronic
1195057641 X:101161975-101161997 CTGTCCCCCAGGCTGGAGTGCGG + Intronic
1195288955 X:103413426-103413448 CTGTCACCCAGCCTGGAGTGCGG + Intergenic
1198524486 X:137486997-137487019 CTGTCACCCAGGGTGGAGTGTGG - Intergenic
1200091679 X:153638909-153638931 CTCTTCCCCTGCATGGGGTCTGG + Intergenic
1201514003 Y:14797331-14797353 CTGTCCCCCAGGCTGGAGTGCGG + Intronic