ID: 1035422946

View in Genome Browser
Species Human (GRCh38)
Location 7:158744330-158744352
Sequence CCAATCGGTTCGGAGAACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 19
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 17}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035422946 Original CRISPR CCAATCGGTTCGGAGAACCC TGG Intronic
901407298 1:9057861-9057883 CCAATCAGCTGGGAGACCCCTGG + Intronic
1066363569 10:34754665-34754687 CCAATTTGTTCAGAGAAGCCTGG - Intronic
1071299414 10:84245204-84245226 CCAGTGGGTTCTGAGGACCCAGG + Intronic
1090697498 11:129263012-129263034 ACAAACGGTTCTGAGAAACCTGG + Intronic
1102521348 12:113479023-113479045 CAAATCGGTCCGCAGAAGCCGGG + Intergenic
1121517684 14:94563675-94563697 CTGATCGCTTCGGAGACCCCGGG + Exonic
1137739028 16:50747269-50747291 CGAATCAGTTCTGAGAAGCCAGG - Intronic
1145739041 17:27256658-27256680 CCAGTCTGTTTGGAGATCCCAGG - Intergenic
1148109478 17:45136586-45136608 CCAATGGGGTCCCAGAACCCGGG - Exonic
1160836039 19:1124834-1124856 CCAGTCAGTTCGGAGACCCCTGG - Intronic
924987625 2:286925-286947 CCACTGTGTGCGGAGAACCCTGG - Intronic
1179241331 21:39595641-39595663 CCAATGGGTTCTGACATCCCAGG + Intronic
1182264697 22:29105118-29105140 GCAAAAGGTTCGGAGCACCCAGG + Intronic
960472291 3:118081664-118081686 CCAAATGGTTCAGAGAACCAAGG + Intergenic
1029014133 7:97296596-97296618 CCACTGGGTTCTCAGAACCCTGG - Intergenic
1035422946 7:158744330-158744352 CCAATCGGTTCGGAGAACCCTGG + Intronic
1039442940 8:37607994-37608016 CCAAGAGGTCAGGAGAACCCTGG + Intergenic
1041758808 8:61341756-61341778 CCAATCTGTTAGTACAACCCTGG - Intronic
1045997943 8:108385228-108385250 CCACTTGGTTCTGAGAATCCTGG + Intronic