ID: 1035423011

View in Genome Browser
Species Human (GRCh38)
Location 7:158745135-158745157
Sequence CAGAATAATGAGACAGGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 231}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035423006_1035423011 0 Left 1035423006 7:158745112-158745134 CCAACCTAATAAAACAACCAACA 0: 1
1: 0
2: 2
3: 29
4: 421
Right 1035423011 7:158745135-158745157 CAGAATAATGAGACAGGGTCAGG 0: 1
1: 0
2: 0
3: 14
4: 231
1035423007_1035423011 -4 Left 1035423007 7:158745116-158745138 CCTAATAAAACAACCAACACAGA 0: 1
1: 1
2: 2
3: 34
4: 496
Right 1035423011 7:158745135-158745157 CAGAATAATGAGACAGGGTCAGG 0: 1
1: 0
2: 0
3: 14
4: 231
1035423005_1035423011 15 Left 1035423005 7:158745097-158745119 CCAATTACTTTTGCACCAACCTA 0: 30
1: 67
2: 55
3: 30
4: 129
Right 1035423011 7:158745135-158745157 CAGAATAATGAGACAGGGTCAGG 0: 1
1: 0
2: 0
3: 14
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035423011 Original CRISPR CAGAATAATGAGACAGGGTC AGG Intronic
901757499 1:11450251-11450273 AAGAAGAAGGAGACAGGGACAGG + Intergenic
901866762 1:12111614-12111636 CAGAGCCATGAGACAGGGTTGGG + Intronic
902150419 1:14438423-14438445 CAGAATAAGGGGACAGGGAACGG + Intergenic
907161788 1:52376215-52376237 CACAAAAATTAGCCAGGGTCTGG + Intronic
908728196 1:67198931-67198953 AAGGATTTTGAGACAGGGTCTGG - Intronic
909016438 1:70385079-70385101 AAGAAGAATGGGACAGAGTCAGG - Intronic
909543371 1:76815953-76815975 CAGAAAAATAAAGCAGGGTCAGG - Intergenic
909650795 1:77973933-77973955 TAAAATTTTGAGACAGGGTCAGG + Intronic
910725691 1:90336320-90336342 CAGAAGAAGTAGGCAGGGTCAGG + Intergenic
911976345 1:104501532-104501554 CAGAATAATCAGACAAGATAAGG + Intergenic
913137678 1:115908717-115908739 CAGTATAATGAGACAATGTCAGG + Intergenic
914908234 1:151763903-151763925 CAGTATAATGATTAAGGGTCAGG - Intronic
917983336 1:180288861-180288883 CAGAATAATGATACATGTGCAGG + Intronic
919447380 1:197725690-197725712 GAAAATAATGAGACAAGGTGAGG + Intronic
920247505 1:204599669-204599691 CAGAATAATGGGGGAGGATCCGG - Intergenic
920611433 1:207442025-207442047 CAGAATATTGAGACAAGGAAAGG + Intergenic
921607522 1:217173161-217173183 AAGAAAAATAAAACAGGGTCAGG + Intergenic
924024991 1:239822766-239822788 CTGAATAATGAGACATGGAAAGG + Intronic
924177840 1:241410950-241410972 CAGAAGAATGTGACCGTGTCTGG - Intergenic
924254183 1:242165993-242166015 CAGCATAATGGGTCAGGGTGTGG - Intronic
1067295355 10:44972444-44972466 CTGAAAAATCAGAAAGGGTCTGG - Intronic
1067438536 10:46295218-46295240 CAGGAAACTGAGTCAGGGTCAGG + Intronic
1067546226 10:47194483-47194505 CTGAATAATGAGAAAGTCTCTGG + Intergenic
1067634763 10:47993843-47993865 GAGAAGAAAGAGAGAGGGTCAGG + Intergenic
1069491108 10:68861305-68861327 AAGAACAAAGGGACAGGGTCTGG + Intronic
1071502295 10:86212498-86212520 CAGAAAAAAGAGCCAGGCTCTGG + Intronic
1071634554 10:87238484-87238506 CCAAATTTTGAGACAGGGTCTGG + Intergenic
1071670565 10:87605734-87605756 CAGAAGAATTTGACAGGGGCTGG + Intergenic
1072184382 10:93021184-93021206 AAGAAAAAAGATACAGGGTCAGG + Intronic
1074770749 10:116732033-116732055 CAGAAGTAAGAGACAGGGCCAGG + Intronic
1075723461 10:124600154-124600176 CACATTAGGGAGACAGGGTCTGG + Intronic
1076903960 10:133353103-133353125 CAGGAGCCTGAGACAGGGTCGGG + Intergenic
1078407186 11:11080683-11080705 CAGCAGAAAGAGACAGGTTCAGG - Intergenic
1078734312 11:14006111-14006133 ATGAATAATGGGACAGGGTAAGG + Intronic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1079774480 11:24506815-24506837 TAGAATAATGACCTAGGGTCTGG - Intronic
1080535999 11:33222354-33222376 AAGAATAATGAGAAAAGTTCAGG - Intergenic
1080893856 11:36432713-36432735 CAGAAAAAAAAGAAAGGGTCCGG - Intronic
1083839887 11:65298339-65298361 CAGAACACTCAGACAGGGTCAGG + Exonic
1085289014 11:75384093-75384115 AAAAATAATGAAACAGGGGCCGG - Intergenic
1085399816 11:76229215-76229237 CTGTTTAATGAGGCAGGGTCTGG + Intergenic
1088912755 11:114204428-114204450 AAGAAAAATGAGACCGGGTGTGG - Intronic
1089313006 11:117572487-117572509 CAGAAGAATGAGATAGGGAGGGG - Intronic
1091229412 11:133978026-133978048 CAGGAGAATGAGACAGGCTATGG + Intergenic
1092170928 12:6373776-6373798 CAGAACAAGGAGAATGGGTCAGG - Intronic
1092759964 12:11800897-11800919 TAAAAATATGAGACAGGGTCTGG - Intronic
1093509157 12:19905173-19905195 AAGAATAATAAGACAGGTTAAGG - Intergenic
1094544173 12:31388974-31388996 CAGAAAAATGAGACAGAGCCAGG - Intronic
1095597074 12:43971389-43971411 CAGAATAATGAGATAAGCTGGGG - Intronic
1096400217 12:51299721-51299743 CAGGGTAATGAGAAAGGGTGTGG + Intronic
1096664631 12:53155078-53155100 CATAAAATAGAGACAGGGTCTGG - Intergenic
1096998437 12:55855432-55855454 AAAAAAAAGGAGACAGGGTCAGG - Intergenic
1097450250 12:59729415-59729437 CAGAATAAAGAGAGAGAGGCAGG - Intronic
1099631045 12:85145980-85146002 CTGAATAATCTGACAGGGGCTGG + Intronic
1100887889 12:99092580-99092602 GAGAAAAGTGAGACAGGGTTAGG + Intronic
1102704141 12:114866695-114866717 CAGAAATAAGAGACAGGGACTGG + Intergenic
1103747285 12:123133975-123133997 CAGAGTAATGAGGCTGGGGCCGG - Intronic
1104016117 12:124963571-124963593 CAGAATAAAGAAACAGTGGCCGG + Intronic
1108951858 13:56104484-56104506 AAGAATAAGGAAACAGTGTCAGG + Intergenic
1110186198 13:72677990-72678012 CTGAATAATGAGATAGTTTCAGG + Intergenic
1113190338 13:107738467-107738489 TAGAAGAATGAGAAAGTGTCTGG - Intronic
1116202528 14:41816697-41816719 CAGAATAAAGAGACAAAGTTTGG - Intronic
1116803344 14:49466352-49466374 CAGAATGATGAGACACAATCTGG + Intergenic
1116859164 14:49979817-49979839 CAGTTCAAGGAGACAGGGTCTGG - Intergenic
1118635333 14:67743477-67743499 TATTATACTGAGACAGGGTCTGG - Intronic
1118941765 14:70345804-70345826 GAGAAAAATGAGGTAGGGTCGGG - Intronic
1121386717 14:93534046-93534068 CACAATGTTGAGACAGGGACAGG + Intronic
1124309727 15:28611811-28611833 AAGAAAAATGACACATGGTCGGG - Intergenic
1124547158 15:30640682-30640704 CAGAAAAAAGAGACAGGCTTTGG - Intronic
1124780757 15:32630645-32630667 CAGAAAAAAGAGACAGGCTTTGG - Intronic
1128667565 15:69549626-69549648 CAGAGTAATGAGATAGGGCATGG + Intergenic
1129089647 15:73135572-73135594 CAGAATAGGGAGACAGGGATGGG + Intronic
1129429942 15:75492515-75492537 CAGGACAATGAGAATGGGTCAGG - Intronic
1129614660 15:77088915-77088937 CAGAATATTGAGACAGGAGTGGG - Intergenic
1130716282 15:86338139-86338161 CTGAATTATGAGAAAAGGTCAGG + Intronic
1134468052 16:14496202-14496224 CAGAAGCATGCGTCAGGGTCAGG - Intronic
1134883428 16:17768536-17768558 CAGAATAATGAGGCAAGGACAGG + Intergenic
1135920026 16:26641554-26641576 CAGAAGAATGAGGCAGGGGAGGG - Intergenic
1137571314 16:49568069-49568091 CTGGATAAAGAGACTGGGTCAGG + Intronic
1137632955 16:49960327-49960349 CAGAAGAAAGAGCCAGGGGCTGG + Intergenic
1138380998 16:56602340-56602362 CAGAATACTGAAACAGGGATGGG + Intergenic
1139319684 16:66104203-66104225 CAGAATAATGACCCATGGGCTGG + Intergenic
1139968359 16:70758239-70758261 CATTATAATGGGCCAGGGTCTGG + Intronic
1145049028 17:19645277-19645299 AAGAAAAATAAAACAGGGTCAGG + Intergenic
1145982716 17:29023336-29023358 AAGAATAATGAGATTGGGTAAGG + Intronic
1147653983 17:42078082-42078104 CCAAATAATGAGACAGGCACTGG + Intergenic
1148005491 17:44425189-44425211 CAGAAGGATGAGAAAGGGACAGG + Intronic
1149195426 17:54113781-54113803 CAGAAGACTGACAGAGGGTCAGG - Intergenic
1151139904 17:71981305-71981327 CAGAATAATGTAACAGTGTTTGG - Intergenic
1151811636 17:76446629-76446651 CTGAGTCATGAGACAGGTTCAGG - Intronic
1156513421 18:37660441-37660463 CAGAAATAGGAGTCAGGGTCAGG + Intergenic
1156549291 18:37998633-37998655 AAGAATAAGGAGACATAGTCTGG + Intergenic
1158082320 18:53607205-53607227 CAGAAAGATGGGACAGAGTCAGG - Intergenic
1159437377 18:68436440-68436462 CACACTAAGGAGAAAGGGTCTGG + Intergenic
1159691501 18:71494142-71494164 TATAATAATGAGACAAGGACAGG - Intergenic
1160999372 19:1902083-1902105 CACAGTAATGCGTCAGGGTCCGG - Intergenic
1163755839 19:19105771-19105793 CAGAAGAAAGAGAGAGGGGCGGG - Intronic
1163930404 19:20385112-20385134 CAGAATAGTGATCCAGGTTCTGG + Intergenic
1165391535 19:35541985-35542007 CAGCATATGGAGAAAGGGTCTGG + Intronic
1165648439 19:37465710-37465732 CAGAATAATTGGATAGGTTCTGG + Intronic
1166365669 19:42277239-42277261 CAGGATTTTGAGACAGAGTCTGG + Intronic
1166791817 19:45403248-45403270 CATTATAATAACACAGGGTCTGG + Intronic
1167345146 19:48940842-48940864 CACAAAAAGGAGACAGGGTCTGG - Intronic
925571827 2:5320821-5320843 CAGAATCAAGAGACAGGTTTTGG - Intergenic
927537044 2:23871532-23871554 AAGAAAAAGGAGACAGAGTCAGG - Intronic
927871624 2:26627771-26627793 CAAAATAATGAGAAAGGGTGAGG - Intronic
928423394 2:31157752-31157774 CATAATCATGAGGCAGGGTATGG - Intergenic
928586004 2:32759019-32759041 AAAAATAATGCGAAAGGGTCTGG + Intronic
929561940 2:42961562-42961584 CAGGACCATGAGTCAGGGTCAGG - Intergenic
930280784 2:49367440-49367462 CAGAACAAGAAGACAGGCTCAGG + Intergenic
930636130 2:53807709-53807731 AAGAATAATGAGACAAGGTTGGG + Intronic
931268099 2:60678384-60678406 CAGAATCATGAGACAGGTCAGGG - Intergenic
933769507 2:85734175-85734197 CAGAATCATGAGACAGGAGCTGG + Intergenic
939480855 2:142745330-142745352 CAGGATAATGTGACAGAGGCTGG - Intergenic
939821453 2:146961525-146961547 CAGAAAGATGAGACAAAGTCTGG - Intergenic
940007147 2:149018384-149018406 TAGAATGAGGAGACAGGATCAGG - Intronic
942034300 2:171995964-171995986 CAAAACAAAGAGGCAGGGTCAGG + Intronic
942121370 2:172781318-172781340 CAGAAGAATAAGACAGGGAAGGG + Intronic
942341153 2:174949344-174949366 TAAATGAATGAGACAGGGTCTGG + Intronic
942676217 2:178429140-178429162 CAGAAGAATGAGAATGGGCCAGG - Intergenic
944299419 2:198106217-198106239 CAGGTTAAAGACACAGGGTCTGG - Intronic
945520712 2:210823964-210823986 CAGAACACTGAGAAAGAGTCTGG + Intergenic
946743199 2:222820151-222820173 AAGAATAAGGACAGAGGGTCTGG - Intergenic
946770591 2:223084875-223084897 CTGAATAATGAGAGAGAGCCAGG - Intronic
1171344066 20:24452520-24452542 CAGAAGAATGAGGCAGGGGTTGG - Intergenic
1172706452 20:36885854-36885876 AAGAGGAATGAAACAGGGTCTGG + Intronic
1174408000 20:50314801-50314823 CAGAATAATGTTCCAGGGTATGG + Intergenic
1175456260 20:59117272-59117294 CACAGCAATGACACAGGGTCAGG - Intergenic
1177511370 21:22091775-22091797 AGGAATAATGAGTCGGGGTCAGG + Intergenic
1180720797 22:17906867-17906889 CAGATTAACGTGACAGTGTCAGG - Exonic
1180748963 22:18111288-18111310 CAGCCTAATGTGACAGGGCCCGG + Intronic
1181485542 22:23229453-23229475 CAGAACATTTAAACAGGGTCCGG - Intronic
1182475703 22:30575225-30575247 CTGGAAAATGAGACAGGGCCTGG - Intergenic
1183155226 22:36069716-36069738 CAGAATAGAGAGAGAGGGTGAGG + Intergenic
1183674898 22:39293702-39293724 CAGAATAAGGGTGCAGGGTCAGG - Intergenic
949271454 3:2222691-2222713 CAGAAAAATGAGTCAGATTCAGG + Intronic
949570391 3:5286487-5286509 CAAAATAAGAAGACAGTGTCTGG - Intergenic
954365292 3:50142837-50142859 CAGAATCATGAGGCTGGGGCTGG - Intergenic
954815429 3:53276734-53276756 AAAAAAAATGAGGCAGGGTCTGG + Intergenic
956689737 3:71864536-71864558 CCGAATATTGAGAGAGGGTGGGG + Intergenic
960514146 3:118584344-118584366 CACATTAATTAGACAGAGTCAGG - Intergenic
960809726 3:121616150-121616172 CAGAAGCATCAAACAGGGTCAGG - Intronic
960848302 3:122024771-122024793 CAGAATAATGAGCCTAGGTGAGG + Intergenic
961189428 3:124945532-124945554 AACAATAATGAGACCGGGTGCGG - Intronic
963521451 3:146363205-146363227 CAGAAAAGTGAGAAAGGGTTCGG - Intergenic
964575535 3:158162648-158162670 AAGAATATTGATACAGGGCCTGG + Intronic
967375232 3:188793476-188793498 CAGTATAATGAGAAAGTGGCCGG - Intronic
967380781 3:188855454-188855476 CAGGATAAAGAGACAGAGTCTGG + Intronic
967718576 3:192790727-192790749 CAATATAAGGAGACTGGGTCTGG + Intergenic
968316279 3:197728446-197728468 TAGAATAATCAAACAGGGACGGG + Intronic
970781791 4:19746331-19746353 CACAAATATGAGACAGGGCCTGG - Intergenic
972612999 4:40672403-40672425 CAGGATAAGGAGACAGTGACGGG + Intergenic
975071524 4:70145569-70145591 CCTAATAATGAAAAAGGGTCAGG + Intronic
978159631 4:105530128-105530150 CAGAAAAATGAGGGAGGATCTGG + Intergenic
978753589 4:112280152-112280174 CAGTATAAGCAGACAGTGTCCGG - Intronic
984320266 4:178186708-178186730 TAGAATAGTGAAACAGGGACAGG - Intergenic
989393622 5:40929096-40929118 CAGATTGATGAGACAGAGCCAGG + Intronic
992551506 5:77864913-77864935 CACAAGAAGGTGACAGGGTCAGG + Intronic
995182127 5:109239183-109239205 AAGAATTATGAGCCAGGGCCAGG + Intergenic
995319454 5:110816109-110816131 CAGAACAATGACATAGTGTCTGG + Intergenic
995421446 5:111971941-111971963 CAGAATAAAGAGACAGCCTATGG + Intronic
995533953 5:113117180-113117202 CAGAGTGAGGAGAGAGGGTCGGG - Intronic
996118852 5:119648612-119648634 AAGAAAAATGAAAAAGGGTCTGG + Intergenic
997073412 5:130643409-130643431 GAGAATAAAGGGACAGGCTCTGG + Intergenic
998272925 5:140723756-140723778 CTGAAGAATGAGACTGGGTGCGG - Intergenic
1001180584 5:169516344-169516366 CAGAATAGTAAGATGGGGTCAGG + Intergenic
1001205669 5:169760646-169760668 GAGAATAATGGCACAGGGGCTGG - Intronic
1002375867 5:178788844-178788866 CCGAAGCATGAGACAGCGTCAGG + Intergenic
1002569834 5:180134068-180134090 CAGACTGATGAGGCAGGGCCTGG - Intronic
1003109611 6:3242528-3242550 CATAAGAAGGAGAAAGGGTCAGG - Intronic
1003842868 6:10140306-10140328 CAAAAGAATGAGGCAGGCTCTGG - Intronic
1004963133 6:20815118-20815140 CAAAATAAAGTGACAGGGACTGG - Intronic
1006008699 6:31024383-31024405 AAGGATAATGAGACAGATTCAGG + Intronic
1006282772 6:33068812-33068834 AAGAATGAAGAGATAGGGTCAGG + Intronic
1006536409 6:34702594-34702616 AAGAATCATGAGACAGAGGCCGG + Intergenic
1007089015 6:39170297-39170319 CAGACTAAAGAGCCAGGCTCTGG + Intergenic
1007358180 6:41335751-41335773 TAGAAAAATGAGACAGGCTGAGG - Intronic
1008444194 6:51569648-51569670 CAGAATAATGTGGCAGGCTGTGG - Intergenic
1010807110 6:80250347-80250369 CAGAAGATTGAGACAGAGGCTGG - Intronic
1013371552 6:109475114-109475136 CAGAATAGTGAGTCTGAGTCTGG - Intronic
1013969558 6:116000535-116000557 TAGAAGAATGAGGCAGGGTGTGG - Intronic
1015339419 6:132080706-132080728 CAGAAGATTGAGAAAGGGTTGGG - Intergenic
1016172650 6:141039427-141039449 TAAATTATTGAGACAGGGTCTGG + Intergenic
1019023747 6:168941076-168941098 GTGAATAAAGAGACAGGGTCAGG + Intergenic
1019174187 6:170151713-170151735 CAGCAGAAGGAGACAGGGGCAGG - Intergenic
1021609930 7:22446847-22446869 AAGAGTAATGAGACAGTATCTGG + Intronic
1022259963 7:28694840-28694862 TAGAATTATAAGACTGGGTCAGG - Intronic
1023415900 7:39932165-39932187 AATAATAATGAGACTGGGTGTGG + Intergenic
1023745101 7:43315787-43315809 CTAAATAATGGGACAGGGCCAGG - Intronic
1026442339 7:70455403-70455425 CAGACGAATGAGCCAGGGCCAGG - Intronic
1026615548 7:71899691-71899713 AAGAATAATGTGAGAGGGCCAGG + Intronic
1027181351 7:75941798-75941820 CAAATTATAGAGACAGGGTCTGG - Intronic
1027719240 7:81718222-81718244 CAGAAAAATGAAACTTGGTCTGG - Intronic
1027775082 7:82454914-82454936 CAGGAAAATGAGACAGAGGCTGG + Intergenic
1028954917 7:96677747-96677769 CAGAAAAATGAAAGAGGGTGGGG + Intronic
1029823108 7:103163471-103163493 CTGAGTATTGAGACAGGCTCAGG - Intergenic
1030786995 7:113674642-113674664 CAGAATAATCAGCCAGTGCCTGG - Intergenic
1032161592 7:129514959-129514981 CACAATACTGAGACAGCCTCAGG - Intergenic
1033486867 7:141798893-141798915 CAGAAAAATGAGAAAGGCTTTGG + Intergenic
1034142216 7:148831496-148831518 CAGCAAAATCAGACAGGGTCTGG + Intronic
1034261259 7:149757580-149757602 CAGAATAACCAGACTGGGGCGGG + Intergenic
1035368585 7:158364000-158364022 GAGAAGAATGAAACAGCGTCCGG - Intronic
1035423011 7:158745135-158745157 CAGAATAATGAGACAGGGTCAGG + Intronic
1035423023 7:158745203-158745225 CTATCTAATGAGACAGGGTCAGG + Intronic
1035423036 7:158745271-158745293 CTATCTAATGAGACAGGGTCGGG + Intronic
1036174798 8:6527180-6527202 TAGAATACTGAGGCAGGGTTTGG + Intronic
1036174809 8:6527285-6527307 CAGAATACTGAGGCAGGGTTTGG + Intronic
1037721275 8:21446425-21446447 CCTAATAATGAGACAGGTTTTGG + Intergenic
1037867447 8:22457112-22457134 CAGAATATTGAGAGAGGGGAAGG - Intronic
1038766461 8:30432916-30432938 AAGAAAAATCACACAGGGTCTGG + Intronic
1038779045 8:30555655-30555677 TAGAATAATGTGACAAGGGCTGG - Intronic
1039839543 8:41284156-41284178 AAGAATAATAAGAAAGAGTCTGG + Intronic
1040857740 8:51967698-51967720 AAGAATAATAAAAGAGGGTCAGG + Intergenic
1041005963 8:53497266-53497288 CAGGACAATGAGACAGGGCATGG + Intergenic
1041632919 8:60108358-60108380 CAAAATGATGAGACAGGGAAAGG + Intergenic
1046308143 8:112398047-112398069 CACAATGATGAGACAGGCACGGG + Intronic
1051747165 9:20306064-20306086 CAGAATAATGTGACTGTGTTTGG - Intergenic
1052210271 9:25894900-25894922 CAGAAAAATGTGAGAGGGTTTGG - Intergenic
1054813863 9:69455975-69455997 CAGACAAATAAAACAGGGTCAGG - Intronic
1054838258 9:69703881-69703903 TAGAACAATGAGACAAGATCAGG - Intergenic
1054924958 9:70579851-70579873 AAGAAAAGTGAGACAGGGTGTGG - Intronic
1055036425 9:71823166-71823188 CAGAATAATTAGATGGGGCCAGG - Intergenic
1055262842 9:74458878-74458900 CAAATTAAAGAGACAGCGTCAGG - Intergenic
1055850214 9:80618600-80618622 CAGAATAATGATTCTGGGTAGGG + Intergenic
1056684584 9:88749022-88749044 CAGTATAATGAGACTCGGCCAGG + Intergenic
1057918535 9:99076446-99076468 CAGAGAAATGAGACAGGGATGGG + Intergenic
1058077345 9:100664466-100664488 CACTAGAATGAGACAGGGCCTGG + Intergenic
1059471686 9:114509685-114509707 CATAATGATGAGACAGACTCAGG - Intergenic
1061680053 9:132238538-132238560 CAGGCTAATAAGAAAGGGTCTGG + Intronic
1187188175 X:17007671-17007693 CAGATTAATGTGACAAGTTCTGG - Intronic
1188105310 X:26141751-26141773 CATATTTTTGAGACAGGGTCTGG + Intergenic
1188566145 X:31528833-31528855 AATAATAATCACACAGGGTCAGG + Intronic
1189384153 X:40523587-40523609 CAGAAGAAGGTCACAGGGTCAGG - Intergenic
1190375288 X:49783180-49783202 CAGAAAAATAAGGCAGGGTCAGG + Intergenic
1193549894 X:82879079-82879101 AAGAATAATCAGCCAGGGTTGGG - Intergenic
1194694145 X:97024885-97024907 CAGAAAAATGAAACAGGGAATGG - Intronic
1195573972 X:106429149-106429171 AAGAATAATGAGGAAAGGTCTGG - Intergenic
1196517315 X:116628760-116628782 CAAAAGAATGAGACAGGGACAGG + Intergenic
1197030101 X:121802922-121802944 AAGAAGCATGAGTCAGGGTCAGG + Intergenic
1197528767 X:127596182-127596204 CAGAATGATGAAACAGTATCGGG - Intergenic
1198116227 X:133547680-133547702 CATTATTTTGAGACAGGGTCTGG + Intronic
1200173395 X:154095866-154095888 CCCTATAATAAGACAGGGTCTGG - Intronic
1200206041 X:154317057-154317079 CAGCTTAATGAGCCAGGCTCGGG - Intronic
1200709866 Y:6473772-6473794 CACATTCATGAGACAGGATCAGG + Intergenic
1201024247 Y:9690936-9690958 CACATTCATGAGACAGGATCAGG - Intergenic
1202150822 Y:21842344-21842366 CACATTAATGAGGCAGGCTCTGG + Intergenic