ID: 1035423898

View in Genome Browser
Species Human (GRCh38)
Location 7:158754096-158754118
Sequence CAGGCAGGTGCCCCGTCGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035423895_1035423898 -9 Left 1035423895 7:158754082-158754104 CCAGGCAAGTGCTTCAGGCAGGT 0: 1
1: 0
2: 1
3: 13
4: 181
Right 1035423898 7:158754096-158754118 CAGGCAGGTGCCCCGTCGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035423898 Original CRISPR CAGGCAGGTGCCCCGTCGGG AGG Intronic
No off target data available for this crispr