ID: 1035424313

View in Genome Browser
Species Human (GRCh38)
Location 7:158757567-158757589
Sequence CCGCGAGCTCTGGGATCCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 2, 1: 0, 2: 1, 3: 6, 4: 78}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035424313_1035424318 3 Left 1035424313 7:158757567-158757589 CCAAAGGATCCCAGAGCTCGCGG 0: 2
1: 0
2: 1
3: 6
4: 78
Right 1035424318 7:158757593-158757615 GCCCCTTAATCCAGAGCCAAAGG 0: 1
1: 1
2: 0
3: 8
4: 93
1035424313_1035424324 19 Left 1035424313 7:158757567-158757589 CCAAAGGATCCCAGAGCTCGCGG 0: 2
1: 0
2: 1
3: 6
4: 78
Right 1035424324 7:158757609-158757631 CCAAAGGATCCTAGAGCCCGCGG 0: 1
1: 0
2: 2
3: 2
4: 78
1035424313_1035424325 20 Left 1035424313 7:158757567-158757589 CCAAAGGATCCCAGAGCTCGCGG 0: 2
1: 0
2: 1
3: 6
4: 78
Right 1035424325 7:158757610-158757632 CAAAGGATCCTAGAGCCCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035424313 Original CRISPR CCGCGAGCTCTGGGATCCTT TGG (reversed) Intronic
903057859 1:20648875-20648897 ACTCAAGCTCTGGGTTCCTTGGG + Intronic
903652559 1:24930491-24930513 CCGAGAGCTCTGGGAGCCCGGGG + Intronic
905804168 1:40863858-40863880 CCCCGACCTGTGGCATCCTTGGG + Intergenic
915294168 1:154908525-154908547 CCCTGAGCTCTGGGACCCTGTGG - Intergenic
916039588 1:160950793-160950815 CTGAGAGCTCTGGGATCAGTAGG + Intronic
922176727 1:223202924-223202946 CCACCAGCTCTGGGATCCCCAGG + Intergenic
1063265929 10:4450836-4450858 CCTAGGGCTCTGGGTTCCTTGGG + Intergenic
1065554945 10:26905825-26905847 CCCCGAGCTGTGGGCTCCTGTGG + Intergenic
1068534673 10:58228976-58228998 CCCTGAGTTCTGAGATCCTTTGG - Intronic
1076303012 10:129442032-129442054 CCTGAAGCTGTGGGATCCTTGGG - Intergenic
1079413539 11:20211946-20211968 CCTCTAGCTCTGGGCTCTTTGGG + Intergenic
1084170655 11:67399356-67399378 CCGGGAGCTCTGTGCTCCTGAGG - Intronic
1089130428 11:116207949-116207971 CCGCAGCCTCTGGGATCCTGCGG - Intergenic
1095414264 12:41958955-41958977 CCCAGAACTCTGGGATCCTGAGG + Intergenic
1096829058 12:54300582-54300604 TTGGGTGCTCTGGGATCCTTGGG - Intronic
1104597072 12:130127117-130127139 TCGCCAGCTCTGTGTTCCTTGGG - Intergenic
1105862983 13:24433299-24433321 CCCCGAGCTCTGGGAGCCCACGG - Intronic
1113573882 13:111381265-111381287 CTGAGAGCACTGGGGTCCTTAGG + Intergenic
1118525152 14:66632078-66632100 CTGCTAGCTCTGAGATCTTTGGG + Intronic
1123034167 14:105465109-105465131 CAGCGGGCTCTGGGAGGCTTCGG - Exonic
1127204580 15:56700889-56700911 CGGCCAGCTCAGGGATCCATTGG - Intronic
1132557356 16:578529-578551 CAGCAAGCTCTGGGGTCCCTGGG - Intronic
1132883218 16:2171400-2171422 CCGAGAGCCCTGGGGTCCTGTGG - Intronic
1139437382 16:66943974-66943996 CCTCGAGCTCCTGGATCTTTTGG - Exonic
1141032078 16:80597627-80597649 CCCCCAGTTCTGGGATCCTCTGG + Intergenic
1141400186 16:83740658-83740680 CCAGGAGCTCTGGGATGCCTGGG + Intronic
1141435418 16:83997135-83997157 CCAGGAGCTCTGGGATCCCTGGG - Intronic
1142322292 16:89391311-89391333 CCGCAAGCCCTGGGTTCCTGTGG - Intronic
1142352127 16:89585409-89585431 CCCAGGGCCCTGGGATCCTTGGG - Intronic
1152181266 17:78823131-78823153 CCGGGAGCTCTGAAATACTTGGG + Intronic
1152468098 17:80476837-80476859 CCCTGAGCTCTCGGAGCCTTCGG - Intronic
1153976477 18:10272430-10272452 CCCAGAGCTCTGGCATTCTTGGG + Intergenic
1157271824 18:46282099-46282121 CCGGGTGCTCTGGGATCATTTGG + Intergenic
1161210109 19:3061790-3061812 CCTCTAGCCCGGGGATCCTTTGG - Intronic
929778553 2:44943214-44943236 CCGCCAGCTCGGCGATCCTCTGG + Intronic
929789577 2:45013269-45013291 CCTCGGGCTCTGGGATGCTCCGG + Intergenic
935690769 2:105730390-105730412 CCCTGAGCTCTGGGTTCCTCAGG - Intergenic
938000852 2:127735349-127735371 CACCGAGCTTTGGGATCCTATGG - Intronic
942816769 2:180061340-180061362 CCCCGAGCTCTGGGAGCCCATGG - Intergenic
946192991 2:218017221-218017243 CAGAGGGGTCTGGGATCCTTGGG - Intergenic
1168767195 20:389603-389625 CCCAGAGTTCTGGGCTCCTTAGG - Intronic
1172330758 20:34074733-34074755 CCTCCAGCTCTGGGATTCTGTGG + Intronic
1172572438 20:35981214-35981236 CAGCAAGCTGTGGGTTCCTTGGG + Intronic
1174295856 20:49544525-49544547 GCTTGAGCTCTGGGACCCTTAGG - Intronic
1174298827 20:49567958-49567980 CCGCGGGCTCCGAGACCCTTGGG + Intronic
1176033590 20:63025600-63025622 TCACGGGCTCTGGGATCCTGCGG + Intergenic
1179233815 21:39527946-39527968 CTGCGAGCTTTGGGATTCTTTGG - Intergenic
1181619293 22:24077558-24077580 CCGTGAGCTCTGAGGGCCTTTGG + Intronic
1182349640 22:29692108-29692130 CCGAGGGCCCTGGGAGCCTTCGG - Intronic
1182801958 22:33038861-33038883 CCTGCAGCTCAGGGATCCTTTGG - Intronic
1182802496 22:33042877-33042899 CCTGCAGCTCAGGGATCCTTTGG - Intronic
1183829628 22:40410895-40410917 CAGGGAGCCCTGGGATCCTGGGG + Exonic
1184687201 22:46102074-46102096 CCGTGGGCTCTGGGAGCCTCAGG - Intronic
955072514 3:55583776-55583798 CAGTGAGCTCTCGGATACTTGGG - Intronic
956819619 3:72941957-72941979 CCAGGAGCCCTGGGTTCCTTTGG - Intronic
962251609 3:133839421-133839443 CAGGGAGCTCTGGGATGCATGGG - Intronic
962257309 3:133881190-133881212 CTGCGAGCTCTGGGTCCCTAAGG + Intronic
962321323 3:134392930-134392952 CAGCTCACTCTGGGATCCTTGGG - Intergenic
980550611 4:134328960-134328982 CGGGGAGCTCTGGCTTCCTTTGG + Intergenic
983824882 4:172247258-172247280 CCACAAGCTCTGGGACCCTAGGG + Intronic
984296544 4:177861644-177861666 CCGAGAGCACAGGGATCCTGGGG - Intronic
985689312 5:1298395-1298417 CCCTGAGGTCTGGGATCCTTCGG - Intergenic
986630328 5:9766523-9766545 AGGTGACCTCTGGGATCCTTTGG - Intergenic
988456799 5:31394018-31394040 CCCCGAGCTCTGGGAGCCCACGG + Intergenic
990677377 5:58202844-58202866 CCTCGAGCTCTGGTTTCCCTGGG - Intergenic
997371161 5:133361479-133361501 CAGGGAGCCCTGAGATCCTTGGG - Intronic
997465462 5:134084997-134085019 CTGGGATCTCTGGGGTCCTTGGG + Intergenic
1003816918 6:9851623-9851645 CCTTGAGGTCTGGGATGCTTGGG + Intronic
1005549309 6:26897920-26897942 CCGGGAGGTCTGGGATCTATGGG - Intergenic
1014931364 6:127340460-127340482 CCTAGAGCTCAGGGTTCCTTAGG + Intronic
1019915453 7:4129456-4129478 CCGGGAGCTCTGGCCTCCTTGGG - Intronic
1024508817 7:50186356-50186378 CGGTGGGCTCTGGGCTCCTTGGG + Intergenic
1028997446 7:97117120-97117142 CCGCCAGCTCTGGGCTCACTTGG + Exonic
1035065445 7:156100988-156101010 CTTGGAGCTCTGGGATCCTGGGG + Intergenic
1035424303 7:158757525-158757547 CCGCGAGCTCTGGGATCCTTTGG - Intronic
1035424313 7:158757567-158757589 CCGCGAGCTCTGGGATCCTTTGG - Intronic
1035424323 7:158757609-158757631 CCGCGGGCTCTAGGATCCTTTGG - Intronic
1035580668 8:737725-737747 CCGCGAGCCCCGGGAGCCGTCGG + Intronic
1038930827 8:32191807-32191829 CCTCCAACTCTGAGATCCTTTGG - Intronic
1042218083 8:66446464-66446486 CAGTGAGCTCTGGGAACCTCAGG - Intronic
1049017502 8:139931128-139931150 CCGCAAGCTGTGAGATCCTCGGG + Intronic
1049456426 8:142693339-142693361 CCCAGAGGTGTGGGATCCTTTGG - Intergenic
1060113846 9:120925966-120925988 CAGAGAGCCCTGGGCTCCTTTGG + Exonic
1060827866 9:126696680-126696702 CCGAGAGCTCTGGGTCCCTGGGG - Exonic
1061548725 9:131320134-131320156 GCGGGAGCTCTGGGAACCCTGGG + Intergenic
1061832738 9:133305942-133305964 CGGCCAGCTCTGCGCTCCTTTGG - Intergenic
1185561664 X:1064614-1064636 CTGTGAGCTTTGGGATCCTTTGG - Intergenic