ID: 1035425960

View in Genome Browser
Species Human (GRCh38)
Location 7:158773379-158773401
Sequence AACAGCTTTTAGAAATTAAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 557
Summary {0: 1, 1: 0, 2: 1, 3: 47, 4: 508}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035425960 Original CRISPR AACAGCTTTTAGAAATTAAC TGG (reversed) Exonic
900280067 1:1861303-1861325 AAAATTTTTTAAAAATTAACTGG + Intronic
901589075 1:10324171-10324193 AACAGCATTTAGAAAGTACAGGG - Intronic
902819350 1:18934227-18934249 AATAATTTTTAAAAATTAACTGG - Intronic
903602535 1:24553306-24553328 AACAAATTTTAAAAATTAGCCGG - Intergenic
903630507 1:24765971-24765993 AACAAATTTTAAAAATTAGCCGG - Intronic
903669923 1:25029282-25029304 AACAGGTTTTGAAAATTAAATGG - Intergenic
905010198 1:34742028-34742050 AACAGCCTTTAGGAATTAGAGGG + Intronic
905023595 1:34835154-34835176 AAAAAATTTTAAAAATTAACTGG + Intronic
906002604 1:42439780-42439802 AACAGATTTTGGAAATATACAGG + Intronic
906443614 1:45873740-45873762 AACAGCTTGATGATATTAACAGG - Intronic
907347359 1:53793749-53793771 AAAAACATTTAAAAATTAACCGG - Intronic
907686847 1:56620080-56620102 AACAAAATTTAAAAATTAACCGG + Intronic
908490213 1:64635803-64635825 AACAGATTTTTGAAAATAAAAGG - Intronic
909295734 1:73946357-73946379 AAGAGTTTTTCGAAATGAACAGG + Intergenic
909477637 1:76098533-76098555 AACACCTTTTAGATATTTATTGG + Intronic
909530978 1:76681489-76681511 AACAGCTCTTACAATTTAATGGG + Intergenic
909636626 1:77823835-77823857 AACAGAGTTTAGAATTCAACAGG - Intronic
909656690 1:78040734-78040756 AACAGAATTTAGAAATTGAAAGG + Intronic
909745880 1:79096475-79096497 AAAAAATTTTAAAAATTAACCGG - Intergenic
909842257 1:80342808-80342830 AAAATCTTTAAGAAATTAATAGG + Intergenic
911078184 1:93900454-93900476 AACAGCAATGTGAAATTAACAGG + Intronic
913435597 1:118844436-118844458 ACCAGCCTTTAGAGATTCACAGG - Intergenic
913658018 1:120980104-120980126 AACAGGTTTTAGAGATTATTGGG - Intergenic
914009373 1:143763173-143763195 AACAGGTTTTAGAGATTATTGGG - Intergenic
914087579 1:144467078-144467100 AACATCTTTCAGGAATTAAGGGG + Intergenic
914193352 1:145430055-145430077 AACATCTTTCAGGAATTAAGGGG + Intergenic
914311032 1:146467129-146467151 AACATCTTTCAGGAATTAAGGGG - Intergenic
914325157 1:146606521-146606543 AACAGGTTCTAGAAATAAAAAGG - Intergenic
914647999 1:149671848-149671870 AACAGGTTTTAGAGATTATTGGG - Intergenic
915985953 1:160464995-160465017 AAAAGCTTTCAAAAATTAGCTGG - Intergenic
916432037 1:164739574-164739596 ATCTGCTTTTAGAAATGAAAGGG - Intronic
916553195 1:165869812-165869834 AAAAGTTTTTAAAAATTAGCTGG - Intronic
916971613 1:170025579-170025601 AACAGCCTTTATACATCAACAGG - Intronic
917325582 1:173828414-173828436 AGAAGCTTTTAGATAATAACAGG - Intronic
917425084 1:174904808-174904830 AACAAATTTTAAAAATTAGCTGG - Intronic
917640608 1:176979933-176979955 ACAATCTTTAAGAAATTAACTGG + Intronic
918589937 1:186229674-186229696 AAAAGTTTTTAGAAATTATCTGG - Intergenic
918621133 1:186607248-186607270 AACAGATTTGTGAAATAAACAGG + Intergenic
918811209 1:189123297-189123319 ACCAACTTTAAGAAATTAACTGG - Intergenic
918867385 1:189920706-189920728 AACAGTTTTTAAAAATTTAGTGG + Intergenic
918940629 1:190992002-190992024 AATAGGTTTTAGAAAATGACTGG - Intergenic
919017158 1:192053289-192053311 AACTTCTTTTAGAAATGAAAAGG - Intergenic
919653709 1:200177408-200177430 AAAAACTTTTAAAAATTATCAGG - Exonic
920862323 1:209720574-209720596 ATCAGCTTGTACAAAATAACTGG + Intronic
921216328 1:212940061-212940083 AACAACTTTTAGGAATAAAAGGG - Intergenic
921616264 1:217271528-217271550 AACATTTTTTAAAAATTACCTGG - Intergenic
922053299 1:222015902-222015924 ACCAGCTTTTTGAATTTAATTGG - Intergenic
923662789 1:235972906-235972928 AAAATCTTTTAAAAATTAGCCGG - Intergenic
923780038 1:237013986-237014008 AAAAACTTTTAAAAATTAGCAGG + Intergenic
923800158 1:237201238-237201260 AATAGACTTTAGAAGTTAACAGG - Intronic
923887445 1:238174921-238174943 CACATCTTTTAGAAATTAAAAGG - Intergenic
924128332 1:240879481-240879503 AACAGCTTTCAAAAATGAATGGG - Intronic
924169447 1:241322453-241322475 AGCTGCTATTAGAGATTAACTGG - Intronic
924674966 1:246166551-246166573 AACAGCCTTTAAGAATTAACAGG - Intronic
924723200 1:246643049-246643071 AAAAATTTTTAAAAATTAACTGG - Intronic
1063779317 10:9303381-9303403 AACAGGTTGTAGAAATAAAATGG - Intergenic
1064386703 10:14900189-14900211 AAGAGCTTTCAGACATTAAAAGG - Intronic
1064891344 10:20177605-20177627 AAAAGTTTTAACAAATTAACTGG + Intronic
1065029402 10:21569724-21569746 AAGATTTTTTAAAAATTAACTGG - Intronic
1065113011 10:22458520-22458542 AAAAAGTTTTAAAAATTAACTGG + Intergenic
1065137352 10:22685201-22685223 AACTCCTTTTAAAAATTATCTGG - Intronic
1065672623 10:28137237-28137259 AATATCTTTTAGAAATGAAGGGG + Intronic
1065806825 10:29400688-29400710 AAAAAATTTTAAAAATTAACTGG + Intergenic
1066142343 10:32518025-32518047 AACAGATTCTAGAAATTGTCAGG + Intronic
1066265187 10:33769979-33770001 AACAGATTTTAGAAAAGAAAGGG + Intergenic
1066400639 10:35072712-35072734 AACTGCATTTAGGAATTAGCTGG + Intronic
1066462257 10:35622317-35622339 AAAAGTTTTTAAAAATTAGCTGG - Intergenic
1066641280 10:37556657-37556679 AAAAGATTTTAAAAATTAGCTGG - Intergenic
1067376567 10:45732772-45732794 TTCAGCTTTTATAAATCAACAGG - Intronic
1067424746 10:46198242-46198264 CACAGCTTTTTGAAATTTATGGG - Intergenic
1067884262 10:50073463-50073485 TTCAGCTTTTATAAATCAACAGG - Intronic
1068345328 10:55770465-55770487 CACAGCTTTTTGAAATTTATGGG + Intergenic
1068509232 10:57942879-57942901 AAAATGTTTTACAAATTAACAGG + Intergenic
1068672466 10:59737762-59737784 AACAGGTTTTAAAAACTACCTGG + Intergenic
1068963154 10:62885641-62885663 AACAGCTATTAGCAGTCAACAGG - Intronic
1069517963 10:69094748-69094770 AAAAGATTTTAAAAATTAGCTGG - Intronic
1069608576 10:69757045-69757067 AAGAGCTTCTGGAAATGAACTGG - Intergenic
1070716136 10:78722719-78722741 AAAATATTTTAAAAATTAACTGG + Intergenic
1073050943 10:100667005-100667027 AACAAATTTTAAAAATTAGCTGG - Intergenic
1073393218 10:103196075-103196097 AACAGTTTTTAAAAATCAGCCGG + Intergenic
1074354600 10:112770910-112770932 GACATGTTTTAGAAATAAACAGG + Intronic
1074586968 10:114777248-114777270 AACACATTTTAGAAATGAAAAGG - Intergenic
1075433847 10:122416575-122416597 AACAGCTTTTACTAAGTACCAGG - Intronic
1076289989 10:129338406-129338428 AGCAGGTTTTAGAAATGAAATGG + Intergenic
1076291086 10:129346240-129346262 AACACCTTTTAAAGATTAACTGG - Intergenic
1077789864 11:5426944-5426966 GACAGCTTTGAGAGATTACCTGG + Intronic
1078229735 11:9429342-9429364 AAAAATTTTTAAAAATTAACTGG + Intronic
1078834223 11:15011587-15011609 ATCAACTTTTAAAAATTAAAAGG - Intronic
1078882675 11:15467314-15467336 AACAGCATCTAGAAATTAAAGGG + Intergenic
1079159566 11:17979309-17979331 CACTGCTTGCAGAAATTAACTGG + Intronic
1079639850 11:22791430-22791452 AACTACTTTTAGAAGTTAATGGG + Intronic
1080388033 11:31821044-31821066 AAAATATTGTAGAAATTAACAGG - Intronic
1080673670 11:34405010-34405032 AACAGCATTTAGCAAATAAGTGG - Intergenic
1080765398 11:35291833-35291855 AGCAGCTTTTACAAAGTAAATGG - Intronic
1080821752 11:35813781-35813803 AAAAACTTTTAGGAATTAAAAGG + Exonic
1082804757 11:57440727-57440749 AAAAGCTTTTAAAAATTAGCTGG - Intergenic
1083127692 11:60588165-60588187 CACAGCATTAAGAAATGAACAGG - Intergenic
1084632564 11:70363673-70363695 AGAAGTTTTTAGAAATTAGCTGG - Intronic
1085497818 11:76987776-76987798 AACATTTTTTAAAAATTAGCTGG + Intronic
1085910987 11:80826293-80826315 ATCAGCATTTATACATTAACAGG + Intergenic
1086040336 11:82469183-82469205 AACGGCTTATAGTAATTAGCTGG + Intergenic
1086468592 11:87081056-87081078 CACAGATGTTTGAAATTAACTGG - Intronic
1086934145 11:92725646-92725668 AACAGCTTATAGAAAGCAAATGG - Intronic
1087247730 11:95859386-95859408 AACAGCACTTAGAAAAAAACTGG + Intronic
1087384871 11:97458367-97458389 AATAGTTTTTAGAAATTATCTGG - Intergenic
1087592542 11:100209529-100209551 AGCAACAGTTAGAAATTAACAGG + Intronic
1087860735 11:103151258-103151280 AATATATTTTAAAAATTAACTGG - Intronic
1088085713 11:105977098-105977120 AACACTTTTTAAAAATTACCAGG + Intronic
1088981439 11:114867861-114867883 AAAAGATTTTAAAAATTAGCTGG + Intergenic
1089236481 11:117031252-117031274 AAAAAATTTTAGAAAATAACAGG - Intronic
1091906502 12:4193789-4193811 AAAAGCTTTTAGGCATTTACAGG - Intergenic
1092809158 12:12256112-12256134 AAGAGGTATTAGAAATTACCTGG - Intronic
1092959751 12:13584966-13584988 CACAGCTTTTATAAAATATCTGG - Intronic
1093657884 12:21717949-21717971 AACAGCTGTTGGAAATCAACCGG + Intronic
1094569088 12:31626270-31626292 AACTTCTTTTATAAATTACCCGG - Intergenic
1094770926 12:33658937-33658959 AAAATTTTTTAGAAATTAACTGG - Intergenic
1095214640 12:39533720-39533742 AACAGTCTTTAGAAATTAATAGG + Intergenic
1095255036 12:40024757-40024779 TACAGCATTTAGAAATAAAGAGG + Intronic
1095715063 12:45335317-45335339 AACAGTTTTTAGAAGCTCACAGG - Intronic
1095729890 12:45494932-45494954 AAAAACTTTTAAAAATTAGCTGG + Intergenic
1096293010 12:50358419-50358441 AAAAGTTTTTAAAAATTAGCTGG + Intronic
1096480772 12:51939436-51939458 AAAAACGTTTAAAAATTAACCGG - Intergenic
1096640383 12:52989678-52989700 AAAAAATTTTAGAAGTTAACTGG + Intergenic
1097549493 12:61049251-61049273 AAAAGATTTTAGAAATTAACTGG + Intergenic
1097649147 12:62274482-62274504 AAAAATTTTTAAAAATTAACCGG + Intronic
1097983593 12:65759232-65759254 AACTTCTTTGAGAAATTAAGAGG - Intergenic
1098505442 12:71244352-71244374 AACAGAATGTAGTAATTAACTGG - Intronic
1098744362 12:74217269-74217291 AGCAGCTTTAAGAAATTACCTGG + Intergenic
1099124292 12:78732963-78732985 AATAGGTTTTAAAAATTAAAAGG + Intergenic
1099128793 12:78800234-78800256 CACTGCTTTTAGAGATTCACTGG + Intergenic
1099284734 12:80703520-80703542 AAAAGCCTTTGGAAAGTAACAGG - Intergenic
1099299414 12:80873368-80873390 AACAATTTTTAAAAATTAAGTGG + Intronic
1099864533 12:88262828-88262850 AAAATGTTTTAAAAATTAACAGG - Intergenic
1100319229 12:93474594-93474616 AACTATTTTTAAAAATTAACTGG - Intronic
1100442776 12:94631768-94631790 AACAACATTTAAAAAGTAACAGG + Intronic
1100534410 12:95493318-95493340 AAAAGTTTTTAAAAATTAGCTGG + Intronic
1101009391 12:100433453-100433475 AACATCCTTCAGAAATTAATGGG + Intergenic
1101368200 12:104097423-104097445 AACAACTTTTATAAAACAACTGG - Intronic
1102694291 12:114786085-114786107 AAAAACTTTTAAAAATTAGCTGG - Intergenic
1102953248 12:117044100-117044122 AAAAACTTTTAAAAATTAGCTGG + Intronic
1103570626 12:121842283-121842305 AACAGTTTTAAAAAATTAGCTGG - Intronic
1104043737 12:125146938-125146960 AAAAACTTTTAAAAATTAGCTGG + Intergenic
1104176650 12:126339556-126339578 CACAGCATTTAGAAAATAAATGG + Intergenic
1104772769 12:131374205-131374227 AACAACTTTTAGAAGATAACAGG - Intergenic
1105603327 13:21907023-21907045 AATAGCTTCAAGAAATAAACTGG + Intergenic
1106818738 13:33439643-33439665 AACAACTTTTATACATAAACAGG + Intergenic
1107261408 13:38495709-38495731 ATCAGCTTTTTGAGAGTAACAGG + Intergenic
1107502182 13:40991125-40991147 GACAGTTTTGAGAAATAAACTGG - Intronic
1107786777 13:43965439-43965461 AAAAGCTTTAAAAAATTAACTGG + Intergenic
1108140162 13:47412110-47412132 AAGAGCTTTTAGAATTCAAAAGG + Intergenic
1108504995 13:51104876-51104898 TGCAGCTTGAAGAAATTAACAGG + Intergenic
1108604191 13:52020881-52020903 AAAGGCTTGTAGAAATTAACTGG - Intronic
1109264613 13:60183025-60183047 AATAACTTTTAAAAATTATCAGG + Intergenic
1109742342 13:66570667-66570689 AACAGATTTTAGAAAAGAAAAGG + Intronic
1109857241 13:68146958-68146980 AACATATTTTAAAAATTAGCCGG + Intergenic
1110260679 13:73481711-73481733 GAAAGCTTTTGGATATTAACAGG - Intergenic
1110882657 13:80591300-80591322 AACAATTTTTAAAAACTAACAGG + Intergenic
1111087052 13:83389504-83389526 AACATATTTTAGAAATGAAAAGG + Intergenic
1111288972 13:86137012-86137034 TACAGCTTTTAGATAATTACAGG - Intergenic
1111571788 13:90097893-90097915 AACAGATTTGAGTAAATAACTGG + Intergenic
1111694730 13:91609166-91609188 ACCAGCTCTCTGAAATTAACAGG + Intronic
1112113097 13:96324143-96324165 GACAGTTTTTAGCACTTAACAGG + Intronic
1112271460 13:97974195-97974217 AACAGGTGTTAAAAAGTAACTGG + Intronic
1113069134 13:106402391-106402413 AGCGGATTTTAGAAATTCACAGG + Intergenic
1113186213 13:107688544-107688566 AATTGTTTTTAGAACTTAACAGG + Intronic
1113236854 13:108286083-108286105 AACATCTTTTACAAATAAAATGG - Intronic
1114028468 14:18553117-18553139 AATATCTTTTAGAAATGAAGGGG - Intergenic
1114037397 14:18642868-18642890 AAGAGTTTTTAAAAATTAGCTGG - Intergenic
1114121240 14:19672175-19672197 AAGAGTTTTTAAAAATTAGCTGG + Intergenic
1115460011 14:33649967-33649989 AATAGCTTTCAGACTTTAACAGG + Intronic
1115543732 14:34446320-34446342 AACAGCTTTTCCAAGTTCACAGG + Intronic
1115806493 14:37057568-37057590 AACAACTTTTAAAAAATAAATGG + Intronic
1117593438 14:57300900-57300922 AAAAGGTTTTAAAAATTAGCTGG - Intergenic
1118218317 14:63830497-63830519 AATAATTTTTAAAAATTAACTGG + Intergenic
1118267048 14:64304712-64304734 AAAATCTTTTAAAAATTAGCTGG + Intronic
1118267070 14:64304985-64305007 AACTGCTTATAAAAATTAATAGG + Intronic
1118801940 14:69198241-69198263 ACCAACTTTTAGAAATTATATGG - Intronic
1119527070 14:75331191-75331213 AAAATTTTTTAGAAATTAACTGG + Intergenic
1119552905 14:75528713-75528735 GATATCTTTTAGAAACTAACTGG - Intronic
1119882972 14:78116137-78116159 AACATTTTTAAGAAATAAACTGG - Intergenic
1119885624 14:78138616-78138638 AACAGTTTTTAGTGCTTAACAGG - Intergenic
1121929132 14:97956447-97956469 AACAGACTTTAGAAACTACCTGG + Intronic
1122391346 14:101387901-101387923 CACAGAATTTATAAATTAACTGG + Intergenic
1123803325 15:23844971-23844993 AATTGCTTTTAAACATTAACAGG + Intergenic
1124160719 15:27266556-27266578 GACATTTTTTAGAAATTGACAGG - Intronic
1124255004 15:28133114-28133136 AACAGGTTTTACATTTTAACGGG + Intronic
1124343815 15:28907938-28907960 AACAGATTTTAGAAACGAAAGGG - Intronic
1124964107 15:34420585-34420607 AACAGATTTTAGAAATGAAAGGG + Intronic
1124980720 15:34566813-34566835 AACAGATTTTAGAAATGAAAGGG + Intronic
1125319342 15:38467326-38467348 AAGAGCTTTTATAAATCAACAGG + Intronic
1126238992 15:46419435-46419457 AACAGCTTTTACATATCAAATGG - Intergenic
1126905278 15:53358568-53358590 GCCAGCTTTTAGCAACTAACTGG + Intergenic
1127559036 15:60117620-60117642 AACACATTTTAAAAATTATCTGG - Intergenic
1127652831 15:61025445-61025467 AACAGCTCCCAGAAAATAACAGG - Intronic
1127669179 15:61178385-61178407 AAAATGTTTTAAAAATTAACTGG - Intronic
1128163333 15:65439208-65439230 GACAGCTTAAAGCAATTAACTGG + Intergenic
1128334506 15:66777486-66777508 AAAAGCTTTTGAAAATTAGCTGG + Intronic
1128929152 15:71688778-71688800 CACAGGTTTTAGAAAATTACAGG - Intronic
1128955108 15:71932616-71932638 AACCCCTTCCAGAAATTAACTGG + Intronic
1128986770 15:72227904-72227926 AACAGCTTTAGGAAATAAAATGG + Intronic
1129197729 15:73980884-73980906 AAGAGATTTTAAAAATTAGCCGG + Exonic
1129633302 15:77287030-77287052 AACAGGTTTTAGAGATCTACAGG - Intronic
1130248666 15:82279683-82279705 AACTACTTTTAGAAAGTAAGGGG - Intronic
1131813940 15:96202851-96202873 AACAAATTTTAAAAATTAACTGG + Intergenic
1132168477 15:99621786-99621808 AACTCCTTTAAGAAATAAACAGG - Intronic
1132225162 15:100134661-100134683 AACAGTTTTTAGAAGTTGAAGGG + Intronic
1132347137 15:101115104-101115126 AAAAGTTTTTAAAAATTATCTGG - Intergenic
1132736979 16:1391456-1391478 GAAAGCTTTGAAAAATTAACTGG - Intronic
1132772355 16:1570915-1570937 AAAAACTTTTAAAAATTAGCTGG - Intronic
1133075726 16:3279490-3279512 AAAAAATTTTAAAAATTAACTGG - Intronic
1133174697 16:4005386-4005408 AAAAAATTTTAAAAATTAACTGG - Intronic
1133514838 16:6498433-6498455 AACAGCATTTAGAAGCTAACTGG - Intronic
1133547373 16:6820495-6820517 AAAAGTTTTTAAAAAGTAACTGG + Intronic
1135433540 16:22408452-22408474 AAAAACTTTTAAAAATTAGCAGG - Intronic
1138509288 16:57498621-57498643 AAAAGCATATAGAAATTAGCTGG - Intergenic
1139385031 16:66561758-66561780 AACTGCTTTTCTAAATTACCAGG + Intronic
1139455864 16:67075933-67075955 AAAAATTTTTAAAAATTAACTGG + Intronic
1139616347 16:68096120-68096142 AACAATTTTTAAAAATTAGCTGG - Intronic
1140008408 16:71104426-71104448 AACAGGTTCTAGAAATAAAAAGG + Intronic
1140299495 16:73742449-73742471 AGCAGCATTTAGAAGATAACTGG + Intergenic
1142315394 16:89341525-89341547 TACAGCTTTCAGAAATCAGCTGG - Intronic
1142771498 17:2100703-2100725 AACATTTTTTAAAAATTAGCTGG - Intronic
1143825822 17:9606220-9606242 AAAAGTTTTTAAAAATTAGCCGG + Intronic
1144185631 17:12792567-12792589 TACTGATTTAAGAAATTAACAGG - Intronic
1144368342 17:14567025-14567047 AAAATGTTTTAGAAATTAGCTGG - Intergenic
1145055309 17:19699561-19699583 AAAAGTTTTTAAAAATTAGCTGG - Intronic
1145393385 17:22474745-22474767 AACAAATTTTAAAAATTAGCTGG - Intergenic
1146045232 17:29500001-29500023 AACTCCTTTTAACAATTAACAGG + Intronic
1146435668 17:32844559-32844581 AACATCTTCTAAAAATTAGCTGG + Intronic
1146527355 17:33578383-33578405 AAGAGATTTTAGAAATCATCTGG - Intronic
1146595245 17:34162790-34162812 AAAAGGTTTTAAAAATTAGCTGG - Intronic
1146604346 17:34245541-34245563 ACCAGCATTTAGGAATAAACAGG + Intergenic
1147355350 17:39891510-39891532 AAAAAATTTTAAAAATTAACTGG - Intergenic
1148054175 17:44783885-44783907 AAAACTTTTTAAAAATTAACCGG + Intergenic
1149012827 17:51875133-51875155 AAAAACATTTAGAAATTAGCTGG - Intronic
1149464127 17:56861120-56861142 AACAGTTTTTAGTGATTAAGGGG + Intronic
1149818097 17:59746863-59746885 CAGTGCTTTCAGAAATTAACAGG - Intronic
1149879908 17:60279322-60279344 AATAATTTTTAGAAATTAGCCGG + Intronic
1149911541 17:60571484-60571506 AACACCTATTAGAAATTATGGGG + Intronic
1150845296 17:68651077-68651099 AACAAATTTTAAAAATTAGCTGG + Intergenic
1150961184 17:69914139-69914161 AGCAGCTTTTATAACTTCACTGG + Intergenic
1151841051 17:76617608-76617630 AAAAGTTTTTAAAAATTATCAGG + Intergenic
1152762377 17:82115611-82115633 AAAAGTTTTTAAAAATTAGCTGG + Intronic
1152946284 17:83199196-83199218 AACAGCTCTGAGCAATTAAAGGG - Intergenic
1153377290 18:4395032-4395054 AACAGTCTTTAAAAATTACCCGG + Intronic
1153600599 18:6777561-6777583 AAAAGTTTTTAAAAATTAGCAGG + Intronic
1153752067 18:8242646-8242668 AACAGCTTTTAGCAATAAAAAGG + Intronic
1153830949 18:8922060-8922082 GACAGCTTTGAGAGATTACCTGG - Intergenic
1154365507 18:13704891-13704913 AACCGCATTAAGCAATTAACTGG - Intronic
1155041902 18:22071914-22071936 AACAGCTTTTACAAATGAGTTGG + Intergenic
1155271605 18:24147131-24147153 AACATTTTTTAAAAATTAGCTGG + Intronic
1155822455 18:30395831-30395853 TACAGTTTTTAAAAATTTACAGG + Intergenic
1158142862 18:54274878-54274900 AAGACCTCTTAGAAATTAACAGG + Intronic
1158354347 18:56600082-56600104 CAAAGCTTTTAGACATTAAGAGG + Exonic
1158503524 18:58025446-58025468 AAAATCTTTTAAAAATTAGCTGG + Intergenic
1158609823 18:58928982-58929004 AACAGGTTTTTAAAATTAAGGGG - Intronic
1159191622 18:65052187-65052209 AAAATCTTTTAAAATTTAACTGG + Intergenic
1159361418 18:67409017-67409039 GACAGCTTCAAGAAAATAACTGG - Intergenic
1160067707 18:75592104-75592126 TACAACTTTTAGAAAAAAACAGG - Intergenic
1161620859 19:5296336-5296358 AAAAACTTTTAAAAATTAGCTGG + Intronic
1161786923 19:6332430-6332452 AAAAGTTTTTAAAAATTAGCTGG - Intronic
1162634928 19:11960450-11960472 AAAAACTTTTAAAAATTATCTGG - Intronic
1163068301 19:14815981-14816003 AACATTTTTTCAAAATTAACTGG - Intronic
1163625057 19:18384491-18384513 AAAAAATTTCAGAAATTAACCGG - Intronic
1163656909 19:18551636-18551658 AAAAAATTTTAAAAATTAACTGG - Intergenic
1163772757 19:19200606-19200628 AAAAGATTTTAAAAATTAGCTGG - Intronic
1165553595 19:36609450-36609472 ATCAGCTTTTAAAAATTCATGGG - Intronic
1166388206 19:42393951-42393973 AAAAAATTTTAGAAATTAGCTGG - Intergenic
1166516766 19:43453028-43453050 AAAAACTTTTAAAAATTACCTGG + Intergenic
1166533287 19:43555137-43555159 AACACCTTTTGGAAATGCACAGG + Intronic
925134844 2:1519291-1519313 ACCAGCTTTGAGCAAGTAACAGG - Intronic
925666413 2:6261646-6261668 AACAGCTTGGAGAAAATAAATGG - Intergenic
926235922 2:11043658-11043680 AACAAGTCTTAGAATTTAACAGG + Intergenic
926936935 2:18095416-18095438 AATAGTTTTTAGAAATTCAGTGG + Intronic
927679354 2:25129813-25129835 CACAGCTGTCAGAAATTAAATGG - Intronic
929319461 2:40525055-40525077 AATATCTTTCAGAAATGAACAGG - Intronic
929750557 2:44708162-44708184 AACAGCTGTTAGAAACTGAGAGG + Intronic
930396775 2:50831654-50831676 AACAAGTTTTAGAAATTTAAGGG - Intronic
930725902 2:54681097-54681119 AACAGCGTTTAAAAAGTAGCTGG + Intergenic
932899993 2:75686580-75686602 AAAATCTTTTAAAAATTAGCTGG + Intronic
933357337 2:81228596-81228618 AAAAGTTTTTAAAAATTAGCTGG + Intergenic
933377525 2:81499095-81499117 AATATCTTTCTGAAATTAACAGG + Intergenic
933630962 2:84656939-84656961 TACAGTTTTTAGAAGATAACAGG - Intronic
933750115 2:85597812-85597834 ATCAGCTTTAAGTAATTAACTGG - Intergenic
934168265 2:89316751-89316773 ACCAGCTCTTAGTAATTAAGAGG - Intergenic
934868508 2:97837411-97837433 ACCAGATTTTAGAAAGTAACAGG + Intronic
935373602 2:102373232-102373254 AAGAGCTTTTAAAATTCAACAGG - Intronic
935850138 2:107210046-107210068 AAGAGCTTTTAGAAAAAAAAAGG + Intergenic
936780827 2:116030430-116030452 AACAATTTTTAAAAATTAGCTGG - Intergenic
937016844 2:118613602-118613624 AACAGCTTTTGCAAATGGACAGG + Intergenic
938827277 2:135018496-135018518 AAGAACTTTTAAAAATTAGCTGG - Intronic
938979861 2:136516087-136516109 AAAATCTTTTGGAAATTATCTGG + Intergenic
941581126 2:167296003-167296025 AACTGCTTGTATAAATTAAGTGG - Intergenic
941850658 2:170176776-170176798 AACAGGTTATTAAAATTAACAGG - Intergenic
941876086 2:170434818-170434840 AAAAAGTTTTAAAAATTAACTGG - Intronic
942353269 2:175077560-175077582 ACCAGCTTTTAAAAATAAAGAGG + Intronic
942440221 2:176026843-176026865 AAAAGCTATTAAAAATTATCAGG - Intergenic
942933997 2:181531953-181531975 AAATGGCTTTAGAAATTAACAGG + Intronic
943015846 2:182509662-182509684 AAAATCTTTCAGAAAGTAACAGG + Intronic
944686214 2:202120213-202120235 AAAAACTTTTAAAAATTAGCTGG + Intronic
944744964 2:202646007-202646029 AAAAACTTTTAGGCATTAACAGG - Intronic
944926837 2:204474195-204474217 AACAGCCTTCAGACAATAACGGG - Intergenic
945024609 2:205607995-205608017 CACAGGCTTTAGAAATTAATGGG + Intronic
945474207 2:210262725-210262747 AATGGATTTTAGAATTTAACTGG + Intergenic
945700518 2:213164007-213164029 CACTGCTTTTAAAATTTAACGGG - Intergenic
947603100 2:231466508-231466530 AAAAGCATTTAGAAACAAACAGG - Intronic
947923490 2:233900462-233900484 AACAGCATTTGAAAATTAATTGG + Intergenic
948191236 2:236060899-236060921 AAAAACTTTTAAAAATTAGCTGG + Intronic
948417891 2:237829094-237829116 AACTGCTTTTAAAAATAAAAAGG - Intronic
1169571548 20:6912037-6912059 ACCTGCTTGTAGACATTAACAGG + Intergenic
1170730024 20:18965789-18965811 GACAGCCTTTAGAAACTAAAAGG + Intergenic
1170919342 20:20661975-20661997 AACAACTTTCAGAAACTAAAGGG + Intronic
1171723755 20:28595419-28595441 AACAGCTTTAAAAAATTAAAAGG + Intergenic
1171754304 20:29087639-29087661 AACAGCTTTAAAAAATTAAAAGG - Intergenic
1171859599 20:30384505-30384527 AACAGCTTTAAAAAATTAAAAGG - Intronic
1173964436 20:47101244-47101266 AAAAACTTTTAAAAATTAGCTGG - Intronic
1174000606 20:47371738-47371760 AAAAAATTTTAAAAATTAACTGG + Intergenic
1174885746 20:54331944-54331966 TACTGCTCTAAGAAATTAACAGG + Intergenic
1175798736 20:61788666-61788688 GTCTGCTGTTAGAAATTAACAGG - Intronic
1176979512 21:15364333-15364355 GACACCATTTAGAAATTAAAAGG - Intergenic
1177743862 21:25187290-25187312 AAAAATTTTTAAAAATTAACTGG + Intergenic
1178350537 21:31870239-31870261 AAATGCTTTTAGAAAGTCACTGG + Intergenic
1178789530 21:35687193-35687215 AACGGGATTTAGAAATTAATGGG - Intronic
1179004179 21:37495347-37495369 AAAAACTTTTAAAAATTAGCTGG + Intronic
1179128731 21:38615203-38615225 AACTGCCTTTAGAATTAAACTGG + Intronic
1179680808 21:43020091-43020113 AAAAACATTTAAAAATTAACTGG - Intronic
1180063512 21:45400799-45400821 AATAACTTTTAAAAATTAAGGGG - Intergenic
1180297312 22:10954097-10954119 AACAGCTTTAAAAAATTAAAAGG + Intergenic
1180452591 22:15480169-15480191 AATATCTTTTAGAAATGAAGGGG - Intergenic
1180461522 22:15569916-15569938 AAGAGTTTTTAAAAATTAGCTGG - Intergenic
1181944281 22:26503608-26503630 AACAGCCATTAGAAATGGACAGG + Intronic
1182331994 22:29557587-29557609 AACATTTTTTAAAAATTAGCAGG - Intronic
949586184 3:5440531-5440553 AAGAACTTTTAGAAATTTAGAGG + Intergenic
951607835 3:24456171-24456193 AAAATTTTTTAAAAATTAACTGG + Intronic
952508064 3:34025622-34025644 AAAAACTTTTAAAAATTATCTGG + Intergenic
954658627 3:52213988-52214010 AACAGTTTTTAAATATTAAAGGG - Intronic
955824696 3:62933356-62933378 AACAGAGATTAGAATTTAACAGG + Intergenic
956296836 3:67724172-67724194 GAAAGCTTTTAGAAAATAACTGG - Intergenic
956836691 3:73101583-73101605 ATCAGTTTTTAACAATTAACAGG - Intergenic
956928308 3:74013858-74013880 AACAACTTTGAGAAATAAAGAGG - Intergenic
957440509 3:80240942-80240964 AATAGCTTTTAGAGAGTCACTGG + Intergenic
957607834 3:82427175-82427197 AATATTTTTTAGAAATTAAAAGG + Intergenic
957652039 3:83020062-83020084 AACAACTTTTAGCTAGTAACTGG - Intergenic
958459465 3:94376246-94376268 CACAGCTTTTAGTATTTAGCTGG - Intergenic
958587174 3:96103032-96103054 AACATCCTTTAAAAATTAAATGG - Intergenic
960268865 3:115652544-115652566 AAAAGTTTTTAAAAATTAGCTGG - Intronic
960885177 3:122386389-122386411 AAAAACTTTTAAAAATTAGCTGG + Intronic
962680389 3:137793282-137793304 AACATCTTTTTGAACTTTACGGG + Intergenic
963080688 3:141390992-141391014 AAAAAATTTTAAAAATTAACTGG + Intronic
963215060 3:142736556-142736578 AACAGCACTTAGAAGTTAACTGG - Intronic
963557585 3:146812059-146812081 AACAGCATTGATAAGTTAACAGG - Intergenic
963601027 3:147379128-147379150 ACTAGCTTTTGGAGATTAACTGG + Intergenic
963623927 3:147647127-147647149 AAGACCTTTTAGAAGTTAAAGGG - Intergenic
965077139 3:163993482-163993504 TGCAGCTTTTAGAAATAAAGTGG - Intergenic
965147950 3:164930280-164930302 GACAGCTTCTAGAAAGTAAAAGG + Intergenic
965372995 3:167888288-167888310 GACAGTTTTTGGAAAGTAACTGG - Intergenic
965455430 3:168894225-168894247 GAAAACTTTTAGAAAATAACTGG + Intergenic
967366923 3:188697640-188697662 GATAGCTCTTAGAAAATAACAGG - Intronic
967557979 3:190881456-190881478 AACAGCTTAAATTAATTAACTGG + Intronic
968119013 3:196111287-196111309 ATCAGTTTCTAGAAATTACCAGG - Intergenic
969658494 4:8511406-8511428 TACAGGTTTTAGAGATTAAGAGG - Intergenic
971083679 4:23245132-23245154 AACAGGTTTTAAATATTTACAGG + Intergenic
971867009 4:32185399-32185421 AATAGGTTTAAGAGATTAACAGG - Intergenic
972068499 4:34983347-34983369 CTAAGCTCTTAGAAATTAACTGG - Intergenic
972076750 4:35100188-35100210 AACAAAGTTTAGAAATGAACCGG - Intergenic
972477423 4:39464172-39464194 AAAAGTTTTTAAAAATTAGCTGG + Intronic
972762733 4:42122743-42122765 AACAGCTTTTAAAAATTATATGG - Intronic
972959186 4:44431136-44431158 AACAAATTTTAAAAATTAAGGGG - Intronic
974214930 4:58832903-58832925 AGAAGCCTTTAGAAATTACCAGG - Intergenic
974442324 4:61935532-61935554 AAAAGCTGTTTGAAATTTACTGG + Intronic
974481463 4:62449100-62449122 AACTGCTTTTGGACTTTAACTGG + Intergenic
974584723 4:63857178-63857200 AACTGATTTAAGTAATTAACTGG + Intergenic
974607462 4:64172276-64172298 AACAGCTCTTATAAAACAACTGG - Intergenic
975133056 4:70847205-70847227 AACAACTTTGAAAAATTAGCTGG + Intergenic
975324928 4:73048817-73048839 AAAAAATTTTAGAAATTAGCTGG + Intergenic
976346423 4:84007972-84007994 CAAAACTTTTAGAAAATAACAGG - Intergenic
976736773 4:88318121-88318143 AACAAATGTTAGAAATTAAATGG + Intergenic
976772816 4:88672744-88672766 AACAGATTGTGGAAATTAAATGG + Intronic
977028666 4:91854221-91854243 AACACCTCTTAGAAATTTACTGG - Intergenic
978066393 4:104408422-104408444 AACAGCTTTCAGAAGTAAACTGG - Intergenic
978578026 4:110205416-110205438 AACATTTTTTAAAAATTAGCAGG - Intergenic
978847346 4:113289367-113289389 AAAAACTTTTAAAAATTAGCCGG - Intronic
980277079 4:130667050-130667072 AAAAACTTTAAAAAATTAACCGG + Intergenic
980641136 4:135581928-135581950 AAGAACTTTTACAAATAAACTGG + Intergenic
981303122 4:143213121-143213143 AACAGGTTTTATTAATTAAGTGG - Intronic
981806752 4:148724945-148724967 AAAAACTTTTAAAAATTAGCTGG - Intergenic
981902181 4:149879601-149879623 AAGAGCTTTTAGAAATGCAGAGG - Intergenic
982052762 4:151518819-151518841 AACAGTTTTAAAAAATTAGCTGG - Intronic
982410556 4:155071560-155071582 GACACCCTTTAGAGATTAACTGG - Intergenic
982414908 4:155118834-155118856 AACAGCATTTAGAAACTGAAGGG + Intergenic
982941445 4:161562348-161562370 CACAGCTGTCAGAAATTGACAGG - Intronic
983428930 4:167622715-167622737 AACAGAATTTAAGAATTAACAGG - Intergenic
983531439 4:168813617-168813639 AACATTTTTTAAAAATTAGCTGG - Intronic
984622654 4:181971726-181971748 AACATTTTTTAAAAATTAACAGG - Intergenic
984646629 4:182227247-182227269 AACAGCTCTGAGAAATTAATGGG - Intronic
984651549 4:182275773-182275795 AAAAAGTTTTAGAAATTAACTGG + Intronic
984996085 4:185431373-185431395 AACAGCCTTTAAAAAATTACTGG + Intronic
985437743 4:189948193-189948215 AACAGCTTTAAAAAATTAAAAGG - Intronic
986816072 5:11413312-11413334 AAAACCTTTTAAAAATTAACAGG + Intronic
988411578 5:30892871-30892893 AACAGATTTTAGATATACACAGG - Intergenic
988420269 5:30997667-30997689 AACATCTGTTAGAAATAAAAGGG - Intergenic
990201643 5:53382734-53382756 AAGAGCTTTTAGATAATTACAGG + Intergenic
990502923 5:56414882-56414904 AAAAGTTTTTAAAAATTAGCTGG + Intergenic
991463110 5:66880033-66880055 AACATCTTTTAGTAGTTAAGTGG + Intronic
991635241 5:68698170-68698192 AAAGGCTAATAGAAATTAACTGG + Intergenic
991709596 5:69395348-69395370 AAGAGATTTTAAAAATTAGCTGG + Intronic
991981402 5:72235278-72235300 AAGGGATTTTAGAAATCAACTGG + Intronic
992468140 5:77027757-77027779 TTCAGTTTTTAGTAATTAACTGG - Intergenic
992927774 5:81607897-81607919 AACAGCTTTGGGAAATGTACTGG + Intronic
993202293 5:84831068-84831090 TAGAGCTTTTACACATTAACTGG + Intergenic
994681769 5:102896704-102896726 AACATCTTTAAAAAATTAAATGG + Intronic
994694631 5:103058722-103058744 TTCAGCTTTCAGAAATTCACAGG - Intergenic
994912690 5:105932996-105933018 AAATGCTTTTAAAAATTAGCTGG - Intergenic
995376374 5:111479036-111479058 AAAAACTTTTAAAAATTAGCTGG - Intronic
995680715 5:114716135-114716157 AAAAAATTTTAAAAATTAACTGG - Intergenic
996656729 5:125947707-125947729 AAAATCTTGTAGAAATGAACAGG - Intergenic
998641963 5:144021495-144021517 GACAGCTTTTTGAGATCAACTGG - Intergenic
1000705891 5:164511404-164511426 CAAAGCTTTTAAAAATGAACAGG + Intergenic
1000925965 5:167194550-167194572 AACAGCTTTCATAAAGTCACAGG - Intergenic
1001786841 5:174420962-174420984 AACAGCTATTACAAAATATCTGG - Intergenic
1002069101 5:176668281-176668303 AACAGCTTTTAGAACTCCAAGGG - Intergenic
1004003143 6:11614275-11614297 AACAGATTTTGGAAATTATTCGG - Intergenic
1004733201 6:18379250-18379272 AAGAGCTCTTATAAATTGACAGG + Intergenic
1005284682 6:24312562-24312584 ATCAGCTCATAGAAACTAACTGG - Intronic
1005940978 6:30559411-30559433 AATACCATTAAGAAATTAACAGG + Intronic
1006527014 6:34615276-34615298 ATCATATTTCAGAAATTAACAGG + Intronic
1009988682 6:70813754-70813776 AACAGATTTTAAAAATTTTCTGG - Intronic
1010778753 6:79918469-79918491 AACAGCTTTTACACAAAAACTGG + Intronic
1012051370 6:94349078-94349100 AACAGCTATTTGAAATAAAGAGG + Intergenic
1013093952 6:106927234-106927256 AAAAACTTTTAAAAATTAGCTGG - Intergenic
1013529606 6:111006766-111006788 AAAAACTTTTAAAAATTAGCTGG - Intronic
1013649952 6:112184492-112184514 AAAAGCTGTCAGGAATTAACAGG - Intronic
1015005963 6:128281928-128281950 AACAGCTAAAAGAAATTAAAGGG + Intronic
1015048353 6:128807354-128807376 AACAGATTTTACAAATTGAGAGG + Intergenic
1015357322 6:132294004-132294026 AACAGATTTTATTTATTAACAGG + Intergenic
1015814085 6:137190272-137190294 AAAACCTTTTATAAATAAACTGG - Intergenic
1017034485 6:150254916-150254938 AACTGCTTCTAGAGATTAACTGG - Intergenic
1017263416 6:152414512-152414534 ACCATCTTTTAGGAATTAAATGG - Intronic
1017313861 6:153005711-153005733 GACAGTTTTGAGAAATAAACTGG - Exonic
1017403304 6:154089424-154089446 AAAAGTTTTTTAAAATTAACAGG + Intronic
1017731941 6:157324406-157324428 CCCAGCTTTCAGATATTAACTGG + Intergenic
1018049908 6:159999938-159999960 AACACCTTTTAGTCATTAAAAGG - Intronic
1018280618 6:162181473-162181495 AAATGCTTTTTGAATTTAACGGG + Intronic
1018310543 6:162503765-162503787 AACAGCTTTCAGATATTGAAAGG + Intronic
1019310512 7:358333-358355 AACAAATTTTAAAAATTAGCTGG + Intergenic
1020658718 7:10957250-10957272 AACAGTTTTTAAAAATTTATTGG - Intergenic
1021962449 7:25886387-25886409 AACACATTTGAGAAATTAAAAGG - Intergenic
1021997104 7:26190027-26190049 AACTGCTTTTAAAAATTTAGGGG + Exonic
1023003492 7:35838081-35838103 AAAAGTTTTTAAAAATAAACTGG - Intronic
1023469707 7:40502382-40502404 AACTGCTTTCAAAAATTAGCTGG - Intronic
1023956729 7:44892380-44892402 AAAATATTTTAAAAATTAACTGG - Intergenic
1024530283 7:50385767-50385789 CATTGCTTTTAGAAATTAATAGG - Intronic
1024999534 7:55303453-55303475 AACATCTTTGAGAATGTAACTGG - Intergenic
1025604113 7:63026600-63026622 AACAGCTTTAAAAAACTAAGGGG + Intergenic
1026920389 7:74151231-74151253 AAAAGTTTTTACAAATTAGCTGG + Intergenic
1027496539 7:78894091-78894113 AACAGTTTTTAAAAATCATCTGG - Intronic
1029644308 7:101843647-101843669 AATAGCCTTTAGAAACTGACAGG - Intronic
1030204863 7:106942851-106942873 AACATTTTTTAAAAATTAATTGG - Intergenic
1030537087 7:110781885-110781907 AACTTCTTTGAAAAATTAACAGG + Intronic
1031051591 7:116950814-116950836 AAAAGATTTTAAAAATTAGCTGG - Intergenic
1032058465 7:128703614-128703636 AACAAATTTTAAAAATTAGCTGG + Intergenic
1032413368 7:131716821-131716843 AACAATTTTTAAAAATTAATTGG - Intergenic
1032967971 7:137123518-137123540 AACAGCATGAAGAAAATAACGGG + Intergenic
1033449240 7:141448179-141448201 AACAGCTTTTCCTGATTAACAGG - Intronic
1033520163 7:142152462-142152484 AACTGCTTTAAGAAAGTAAAGGG - Intronic
1034207235 7:149328435-149328457 AAAAAATTTTAAAAATTAACTGG - Intergenic
1034740540 7:153469572-153469594 AACATCTTTTAAAAATTAAGAGG - Intergenic
1034825314 7:154257143-154257165 AAATGTTTTTAAAAATTAACTGG - Intronic
1034898202 7:154891067-154891089 AAAAGTTTTTAGAAAATAGCCGG + Intronic
1035425960 7:158773379-158773401 AACAGCTTTTAGAAATTAACTGG - Exonic
1037193492 8:16156746-16156768 CAGGGCTTTTAGAAATTAACTGG + Intronic
1038163223 8:25060419-25060441 AAAAAATTTTAAAAATTAACTGG - Intergenic
1038905002 8:31891043-31891065 AAAACCTTTTAGAAAAAAACAGG + Intronic
1038980988 8:32759550-32759572 AACAGATTTTGAAAATCAACTGG + Intronic
1039523782 8:38195310-38195332 AACAAATTTTAAAAATTAGCTGG - Intronic
1040063066 8:43120980-43121002 AACATTTTTTAGAAACTAGCAGG - Intronic
1040095104 8:43435220-43435242 GACAGCTTAGAGTAATTAACAGG - Intergenic
1040676961 8:49761977-49761999 AACAGCTATATGAAATTATCTGG - Intergenic
1040836488 8:51736979-51737001 AACAACTCTAAAAAATTAACTGG + Intronic
1041439583 8:57879639-57879661 AACAGCTTCTAGAAATAGAGGGG - Intergenic
1042074155 8:64970275-64970297 AACTGCTTTTAAAAATTATGGGG - Intergenic
1042214142 8:66412620-66412642 AAAATTTTTTAAAAATTAACTGG - Intergenic
1042595487 8:70443203-70443225 AAAAGTTTTTAAAAATTAGCTGG + Intergenic
1043260519 8:78189185-78189207 AACAGCTTTTATACATAAATGGG + Intergenic
1043554017 8:81408978-81409000 AACATTTTTTAAAAATTAGCTGG + Intergenic
1044679451 8:94762738-94762760 AAAAATTTTTAAAAATTAACTGG + Intronic
1044894699 8:96879111-96879133 AGAAGCATCTAGAAATTAACAGG + Intronic
1045179182 8:99761563-99761585 AATAGCTTATAAAAATTAGCTGG - Intronic
1045376998 8:101584504-101584526 AAGAGCTTCTAGACCTTAACAGG - Intronic
1045852557 8:106720105-106720127 ACCAGCTTAAAGAAATTATCTGG - Intronic
1046136142 8:110029853-110029875 AAAAACTTTTAAAAAATAACAGG + Intergenic
1046535824 8:115508936-115508958 AAAACATTTTAGAAATTATCTGG - Intronic
1046642031 8:116742892-116742914 AACAGGTTTAATAAATTAAAAGG + Intronic
1046767649 8:118087384-118087406 AACAGCTATTAGACATTGTCAGG + Intronic
1047951266 8:129937508-129937530 AACGGGTTTTAAAAATTTACAGG - Intronic
1047997686 8:130352314-130352336 ACCAGCTTTTAAAATTTAAGAGG + Intronic
1049628466 8:143637345-143637367 TACAGCCTGAAGAAATTAACAGG - Intronic
1049631195 8:143658650-143658672 AACAGAATTTATAAATTAAAAGG - Intergenic
1049846017 8:144801869-144801891 AAAAACTTTTAAAAATTAGCTGG + Intronic
1050812541 9:9766978-9767000 GACATCTTTTTGAAATTAATGGG - Intronic
1052199370 9:25759204-25759226 AATAGCTTTCAGAAATGAAGGGG + Intergenic
1052381123 9:27772097-27772119 AACACATCTTAGAAGTTAACAGG - Intergenic
1052452250 9:28646447-28646469 AACACCTTTAAGAACTTAACGGG + Intronic
1052617919 9:30866390-30866412 AACAAATTTTAGCAATTAAAAGG - Intergenic
1052642721 9:31189968-31189990 AATTGCTTTTAGGTATTAACAGG - Intergenic
1052689566 9:31800153-31800175 AACAGCACTTTGAAATTTACTGG + Intergenic
1053725849 9:40999625-40999647 AACAGCTTCAAAAAATTAAAAGG - Intergenic
1055209538 9:73773495-73773517 AACAGATTTTAGAAAGTGAGGGG - Intergenic
1056158659 9:83865608-83865630 AAGAGCTCTTGGAAATTAAAAGG - Intronic
1056351905 9:85758329-85758351 AAGAGCTCTTGGAAATTAAAAGG + Intergenic
1057463453 9:95289309-95289331 AACAGTATATATAAATTAACAGG + Intronic
1057515080 9:95714076-95714098 AACAGCTTTTCAAAATGAAATGG - Intergenic
1058291971 9:103253909-103253931 AACAAATTTAAGAAATTAATTGG - Intergenic
1058349262 9:104001736-104001758 AACAGCTTTTAAAAACTGATAGG + Intergenic
1058663846 9:107290894-107290916 AATTTCTTTCAGAAATTAACTGG - Intronic
1058817377 9:108696953-108696975 AAAAGTTTTCAGACATTAACAGG + Intergenic
1060206182 9:121684213-121684235 AAAGGCTGTTGGAAATTAACTGG + Intronic
1060657710 9:125383751-125383773 AACAATTTTTAAAAATTAGCCGG - Intergenic
1060769833 9:126324939-126324961 AAGAGTTTTTAGAAATTTATGGG + Intergenic
1061363969 9:130160971-130160993 AATAGTTTTTAAAAATTAGCAGG - Intergenic
1062140291 9:134953275-134953297 AAAAGCTCTTAGAAAAAAACAGG - Intergenic
1203448965 Un_GL000219v1:92345-92367 AACAGCTTTAAAAAATTAAAAGG + Intergenic
1185920841 X:4090390-4090412 AAAAAATTTTAAAAATTAACTGG + Intergenic
1186717955 X:12273580-12273602 AGAAGCTTCTAGAAATTAAGAGG - Intronic
1187404319 X:18988881-18988903 AACATCTTTTGGAAATCAGCAGG - Intergenic
1187407500 X:19016886-19016908 AACAGTTTTTAAAAATTAGCCGG - Intronic
1188383501 X:29527798-29527820 AAGAACTTTTAAAAATTAAGTGG + Intronic
1188794746 X:34448660-34448682 AACAGTTTTTATAAATTCATCGG + Intergenic
1188956892 X:36443922-36443944 AAAATCTTTTATAAATGAACTGG - Intergenic
1190242299 X:48666869-48666891 AAAATTTTTTAGAAATTAGCTGG + Intergenic
1190263067 X:48810931-48810953 AAGAGCTTTTGGAGTTTAACAGG - Intronic
1190777683 X:53566299-53566321 AAAAGCTTTCAAAAATTAATGGG + Intronic
1190792447 X:53712710-53712732 AAAAGGTTTTAAAAATTAGCTGG + Intergenic
1192104992 X:68306882-68306904 AAAAAATTTTAGAAATTAGCTGG - Intronic
1192469510 X:71385523-71385545 AACAGCTTTTATATATTCAAGGG + Intronic
1192575015 X:72236598-72236620 AAAATCTTTTAAAAATTAGCCGG + Intronic
1192762391 X:74106758-74106780 ACCAGCCTTTACAACTTAACTGG - Intergenic
1193458893 X:81766108-81766130 ATCTGCTTTTTCAAATTAACTGG - Intergenic
1194699054 X:97091433-97091455 AATAGCTTTTAAAAATTTGCTGG - Intronic
1194858319 X:98961901-98961923 AGCAGCTTTTAGCTATTAATGGG - Intergenic
1195166042 X:102221633-102221655 AACATCTTTTAGAAGTTCAAGGG - Exonic
1195192817 X:102465455-102465477 AACATCTTTTAGAAGTTCAAGGG + Exonic
1195376904 X:104236760-104236782 AAAAGATTTTAAAAATTAGCTGG + Intergenic
1196071822 X:111532833-111532855 AACAGCTATTAGGAAGTAAACGG - Intergenic
1196323351 X:114370894-114370916 AAAGGCTCTTAGAAATCAACAGG + Intergenic
1196568326 X:117235049-117235071 CACACCTTTTAGAAATAAACAGG + Intergenic
1196670241 X:118358541-118358563 AAAAGTTTTTAAAAATTATCTGG + Intronic
1196672473 X:118383552-118383574 AACAGTTATTAGAAAATAATTGG + Intronic
1197355585 X:125434935-125434957 AACACCATCAAGAAATTAACAGG - Intergenic
1198820769 X:140645834-140645856 AAAAACTTTTAGAAATTATCAGG - Intergenic
1198893752 X:141428334-141428356 GACAGAGTTTAGAAATTAATTGG - Intergenic
1200316650 X:155139818-155139840 ATCAGGGTTTAGAAATTGACTGG + Intronic
1200806076 Y:7435152-7435174 AACAACTTTTAAAAATGAGCTGG - Intergenic
1200840684 Y:7778218-7778240 ATCAGTTTTTATCAATTAACAGG + Intergenic
1201417831 Y:13765343-13765365 AACAACTTCTAGGAATTACCAGG + Intergenic
1201495093 Y:14584287-14584309 AAAAGATTTTAAAAATTACCTGG - Intronic
1201988655 Y:19998437-19998459 AACAGCTTTTATATATTTATTGG + Intergenic