ID: 1035427466

View in Genome Browser
Species Human (GRCh38)
Location 7:158790020-158790042
Sequence CAGTGGGGAGAGTCCTCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035427461_1035427466 -10 Left 1035427461 7:158790007-158790029 CCTGGTATCAGCCCAGTGGGGAG 0: 1
1: 0
2: 0
3: 17
4: 162
Right 1035427466 7:158790020-158790042 CAGTGGGGAGAGTCCTCCTGGGG No data
1035427455_1035427466 5 Left 1035427455 7:158789992-158790014 CCGACCCTCACGAAGCCTGGTAT 0: 1
1: 0
2: 0
3: 9
4: 78
Right 1035427466 7:158790020-158790042 CAGTGGGGAGAGTCCTCCTGGGG No data
1035427456_1035427466 1 Left 1035427456 7:158789996-158790018 CCCTCACGAAGCCTGGTATCAGC 0: 1
1: 0
2: 0
3: 9
4: 60
Right 1035427466 7:158790020-158790042 CAGTGGGGAGAGTCCTCCTGGGG No data
1035427457_1035427466 0 Left 1035427457 7:158789997-158790019 CCTCACGAAGCCTGGTATCAGCC 0: 1
1: 0
2: 0
3: 6
4: 66
Right 1035427466 7:158790020-158790042 CAGTGGGGAGAGTCCTCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035427466 Original CRISPR CAGTGGGGAGAGTCCTCCTG GGG Intronic
No off target data available for this crispr