ID: 1035430695

View in Genome Browser
Species Human (GRCh38)
Location 7:158818553-158818575
Sequence CACCAGGACTTGCCTGCAAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 178}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035430687_1035430695 17 Left 1035430687 7:158818513-158818535 CCATTTCAGCAGAGGTGGGGGAG 0: 1
1: 0
2: 0
3: 23
4: 231
Right 1035430695 7:158818553-158818575 CACCAGGACTTGCCTGCAAGCGG 0: 1
1: 0
2: 1
3: 17
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035430695 Original CRISPR CACCAGGACTTGCCTGCAAG CGG Intronic
900136816 1:1121264-1121286 CACCAGGACGTGCGTGGACGAGG + Intergenic
901668879 1:10842530-10842552 CACCAGGATTTGCCTACATTTGG - Intergenic
901834330 1:11914090-11914112 CACCAGGACTTGGATTCCAGTGG + Intergenic
903754003 1:25647964-25647986 CTCCAGGTCTTTCCAGCAAGGGG - Intronic
904937248 1:34140409-34140431 TGCCAGGCCTTGCTTGCAAGTGG - Intronic
906778268 1:48549400-48549422 CCTCTGGACTTGCCTGCAATGGG - Intronic
906903960 1:49867688-49867710 CACCAGGTCTGCCTTGCAAGAGG + Intronic
907470395 1:54670178-54670200 CACCATGCCTGGCCTCCAAGAGG - Intronic
910845809 1:91603814-91603836 CACCAGGCCCTGTCTGCAAAAGG - Intergenic
911932903 1:103927516-103927538 CACCAGGTCTTTCTTGCAACAGG + Intergenic
912510377 1:110185662-110185684 CATCAGGATGTGACTGCAAGAGG - Intronic
915492413 1:156258507-156258529 CACCACGCCTGGCCTGAAAGGGG - Intronic
920914524 1:210249406-210249428 TCCCAGGACTTCTCTGCAAGAGG + Intergenic
922142266 1:222899874-222899896 CACCATGCCTGGCCAGCAAGAGG + Intronic
923522322 1:234744997-234745019 CACCACGCCTGGCCTGCATGTGG + Intergenic
924381052 1:243464810-243464832 GACCAGGACTTGAATGCCAGTGG - Intronic
1063657526 10:8006999-8007021 CACCAGGAATTGCCAGCCTGTGG - Intronic
1065153376 10:22845236-22845258 CCCCAGGACTTGTCTGCAATTGG - Intergenic
1067217012 10:44311445-44311467 CTCCAGGTCTCGCCTGCAAAGGG + Intergenic
1067938538 10:50632461-50632483 ATCCAGGACTTGTTTGCAAGTGG - Intergenic
1068449859 10:57171950-57171972 CACCAGGACCTACCTGCAGGTGG + Intergenic
1069630902 10:69896525-69896547 CACCCGGACCTGCCTGGCAGGGG - Intronic
1070550433 10:77486824-77486846 CTCCATGACTTGCCTGCTTGGGG - Intronic
1070918518 10:80169736-80169758 CACCTGAACATGCCTGCCAGAGG - Intronic
1072332762 10:94369674-94369696 CATAAGGACTTGAGTGCAAGTGG - Intergenic
1072545318 10:96432650-96432672 GGCCAGGACTTGCCGGCAAGAGG + Intronic
1073856297 10:107678584-107678606 CACCAGGAATTTCCATCAAGGGG + Intergenic
1073956402 10:108876540-108876562 CACCAGCACTGGCCAGCAAGCGG - Intergenic
1074387501 10:113028299-113028321 CAGCAAGACTTGCATGCAGGGGG + Intronic
1076259765 10:129055996-129056018 AACCAGGACTTGGCTGGCAGGGG - Intergenic
1076380665 10:130022744-130022766 CTCCAGGACCTGCGTGCAGGAGG - Intergenic
1077164987 11:1130888-1130910 CACCAGGACTTGCTTCCCACAGG - Intergenic
1077223455 11:1427369-1427391 CCCCAGGACTACCCTGCACGTGG - Intronic
1078489304 11:11754586-11754608 CACCTGGCCTTGCCTGAATGGGG - Intergenic
1079966184 11:26983085-26983107 CACCAGGCCTGCCCTGCAAGAGG - Intergenic
1080575424 11:33594523-33594545 AGCCAGGACTAGCCTGCTAGAGG - Intronic
1085412902 11:76302073-76302095 ATCCAGGACTTGCCAGGAAGGGG + Intergenic
1085643430 11:78207697-78207719 CCCCAGGACCTGCCTGCATCTGG + Intronic
1091411229 12:240833-240855 CACAAAGACGTGCCTGGAAGGGG + Intronic
1091710892 12:2739633-2739655 CACCAGGGCTTGGCTGGGAGAGG - Intergenic
1093766387 12:22968101-22968123 CACCAGGCCTAGGGTGCAAGAGG + Intergenic
1095210776 12:39492038-39492060 CAGGAGGACTTGCCTGATAGTGG - Intergenic
1095502890 12:42860007-42860029 CACCAGGACTTAGCTCCATGTGG - Intergenic
1095722990 12:45421264-45421286 AAGCAGAACTTGCCTGCATGTGG - Exonic
1096120604 12:49087171-49087193 ATCCATGACTTGCCTTCAAGCGG - Intergenic
1096826975 12:54286943-54286965 CACAAGGACGTTCCTGCAAAAGG - Intronic
1099863756 12:88252824-88252846 CACCATGCCTGGCCTGAAAGAGG - Intergenic
1101860136 12:108475926-108475948 AACAAGGACTTGAGTGCAAGTGG - Intergenic
1102258994 12:111432004-111432026 CACAAGCTCCTGCCTGCAAGGGG - Intronic
1106912330 13:34476228-34476250 GAGCAGGAATTGCCTGAAAGGGG + Intergenic
1107599343 13:41997105-41997127 CACCAGGACTTGTTTTCAACAGG - Intergenic
1108251161 13:48569472-48569494 CACCAAGACTGGCTTGCCAGAGG + Intergenic
1114898526 14:27025996-27026018 CACCAGGACTTGCCTAGGAGTGG + Intergenic
1115990982 14:39149610-39149632 TACCAGGACTTCCATGCACGGGG + Exonic
1117221794 14:53613505-53613527 CACCAAGCCTTGCCTGTGAGTGG - Intergenic
1118048762 14:62003460-62003482 CACAAGCACTTGCTGGCAAGGGG - Intronic
1121837136 14:97102261-97102283 AAGTAGGACTGGCCTGCAAGTGG - Intergenic
1122222901 14:100252747-100252769 CACCATGCCTGGCCTGCAATGGG - Intronic
1122517256 14:102317552-102317574 CTCCAAGACTTCCCCGCAAGTGG - Intronic
1125784505 15:42303321-42303343 CACCAGGCCTGCCTTGCAAGAGG + Intronic
1129241813 15:74256474-74256496 CAGCAGGACTTGCCAGGACGTGG - Intronic
1130118426 15:81025665-81025687 CACCACGCCTGGCCTGCACGTGG + Intronic
1132022225 15:98372582-98372604 CACCAGGACTGGAGGGCAAGTGG - Intergenic
1132128097 15:99247698-99247720 AACCAGGACTTGCCTGCAAATGG + Intronic
1132550865 16:553329-553351 CACCAGGACCTGCCTGGGGGAGG - Exonic
1133056565 16:3148314-3148336 CTGCAGGAGCTGCCTGCAAGAGG - Exonic
1133999334 16:10770319-10770341 CACCTGGGCAGGCCTGCAAGGGG + Exonic
1135823763 16:25707908-25707930 CACCTGGACTCACCTGCTAGTGG + Intronic
1136037681 16:27552661-27552683 CACCATGCCTGGCCTGCAAGTGG + Intronic
1137758168 16:50919124-50919146 GACCAGGCCCTGCCTACAAGTGG - Intergenic
1138501860 16:57451043-57451065 CACCAGGGCTTGTCGGCAACGGG - Exonic
1138571101 16:57873755-57873777 CACCACGTCTGGCCTGCCAGTGG - Intergenic
1140224502 16:73066965-73066987 CCCCAGGCCTTGGCTGGAAGGGG - Intergenic
1142871827 17:2826281-2826303 CACCATGCCTGGCCTGCAGGGGG + Intronic
1143098395 17:4490727-4490749 CACCAGGACTGGCCCCAAAGAGG - Intergenic
1145777306 17:27538445-27538467 CATGAGGACTTGCTTGCTAGGGG - Intronic
1148560952 17:48605705-48605727 AACCTGGACTTGCCTGCATTTGG - Intergenic
1148615761 17:48998415-48998437 CAGCAGGACTTGCAAGGAAGGGG + Intronic
1151138508 17:71970282-71970304 CACCCTGAATTGCCTGCTAGAGG - Intergenic
1151821588 17:76499878-76499900 CCCCAGGCCTGGGCTGCAAGGGG + Intronic
1153944928 18:10009858-10009880 CAGCAGGACAGGCCTGCACGGGG - Intergenic
1154311953 18:13273803-13273825 CACCAGGACAGGACTGCATGAGG - Intronic
1155295237 18:24378835-24378857 CACCAGGAGGTCCCAGCAAGTGG + Intronic
1158103514 18:53858389-53858411 AAACAGGGCTTGCCTGCAAATGG + Intergenic
1158350244 18:56557663-56557685 GACCAGGTCTTGCCCTCAAGGGG - Intergenic
1158723832 18:59950089-59950111 CACTTGGACTTGCTTGCCAGAGG + Intergenic
1160116174 18:76081635-76081657 CATCAGCACTTGCCTGGAAGCGG - Intergenic
1160971180 19:1768448-1768470 CACCGGGACATGCCTGAAGGGGG + Intronic
1161097544 19:2401571-2401593 CTCCATGACCTGCCTGCAATAGG + Intronic
1161778658 19:6277775-6277797 CAGCGGGACTTGCCTGGAGGTGG + Intronic
1162892299 19:13742609-13742631 CACCAGAACTGGCCTGCATTTGG + Intronic
1162962125 19:14134591-14134613 AAGCAGGACTTGCCTGTTAGTGG + Intronic
1164745583 19:30610406-30610428 CACAAGGACTGGCCACCAAGGGG - Intronic
1165193470 19:34082518-34082540 CACCAGGTCTTCCCTACCAGCGG + Intergenic
1166077738 19:40423473-40423495 CACCAGGAGTCGACTGCCAGAGG + Exonic
1166850358 19:45757167-45757189 CACCAGCTTCTGCCTGCAAGAGG - Exonic
925189948 2:1874738-1874760 CTGCTGGAGTTGCCTGCAAGTGG - Intronic
925915081 2:8599412-8599434 AACCAGGACTGGGCTGCAGGAGG + Intergenic
926451435 2:13009011-13009033 GACCTGGCCTTGCCTGTAAGAGG - Intergenic
930113756 2:47701330-47701352 CACCATGCCTGGCCTTCAAGAGG + Intronic
931457715 2:62425075-62425097 CACCAGGACCTGCCCGGGAGAGG - Intergenic
933805682 2:85996853-85996875 CCCCAGGCCTGGCCGGCAAGAGG - Intergenic
944926600 2:204471678-204471700 CACCAGGAGTTTGCTGCTAGAGG + Intergenic
946061485 2:216945276-216945298 AACAAGAACTTGCATGCAAGTGG - Intergenic
946902854 2:224389218-224389240 CACCACAACTGGCCTGCAAAGGG + Intronic
948583353 2:239003171-239003193 CAGCGGGACTTGCGTGCGAGTGG - Intergenic
948595096 2:239074818-239074840 CTCCACGACTTTCCTACAAGAGG + Intronic
1177443797 21:21165450-21165472 CACCAGTACTTGCATGCCTGAGG - Intronic
1177774415 21:25551893-25551915 CACCAGGCCCTACCTCCAAGGGG + Intergenic
1179417337 21:41208999-41209021 CACCTGTACGTGGCTGCAAGAGG - Intronic
1179885362 21:44312010-44312032 CCCCAGGACTGGGCAGCAAGGGG - Intronic
1180961464 22:19764228-19764250 CACCCGGACTCGCCTGCCAAGGG + Exonic
1183613037 22:38923443-38923465 CACCACAGCTGGCCTGCAAGGGG + Intergenic
1184211926 22:43041070-43041092 CACCAGGACTTGCTTCCTATGGG + Intronic
1184535401 22:45083184-45083206 GAACAGGACATGCCTTCAAGAGG - Intergenic
950264470 3:11563941-11563963 CACCGGGGCTTCCCTCCAAGTGG - Intronic
953841472 3:46393143-46393165 CCCCTGCCCTTGCCTGCAAGAGG - Intergenic
955132710 3:56186951-56186973 GACAAGGACTTCCATGCAAGTGG + Intronic
956243617 3:67156243-67156265 CACCAGGCCTACCCTACAAGAGG + Intergenic
957875847 3:86145931-86145953 CACCAAGACTGGCGTGCAAGGGG - Intergenic
959733473 3:109630649-109630671 CACCTGCCCTTGCCTCCAAGTGG + Intergenic
961490565 3:127254255-127254277 CACCAGGACCTGCCCCCACGTGG + Intergenic
961651598 3:128419536-128419558 CACCAGGAGCTGCCAGCAAGGGG + Intergenic
963131349 3:141861075-141861097 CACCAGGACTTTTCTGGATGTGG + Intergenic
963514746 3:146293913-146293935 CACCAGGACTTGTCAGACAGTGG - Intergenic
964743944 3:159994258-159994280 CTCCAGGATGTGCATGCAAGGGG + Intronic
966251281 3:177867682-177867704 CACCAGGCCTACCCTACAAGAGG + Intergenic
966771728 3:183510321-183510343 CACCAGGACCTGCCTTCAGAAGG - Intronic
969291746 4:6244566-6244588 GATCAGCATTTGCCTGCAAGCGG + Intergenic
969381544 4:6802274-6802296 CAGGATGACTTGCCTGGAAGAGG + Intronic
969411537 4:7031671-7031693 CCCCAGGACCAGCCTGCCAGCGG - Exonic
969442351 4:7224798-7224820 CCCCAGGACTGTCCTGGAAGGGG - Intronic
969600114 4:8171249-8171271 CACCACGCCCGGCCTGCAAGTGG + Intergenic
976792983 4:88900613-88900635 CACCAGGCCTGCCTTGCAAGAGG + Intronic
977433591 4:96965070-96965092 CAACAGAAATTGCCTGTAAGAGG - Intergenic
978593950 4:110356523-110356545 CTCCAGTTCTTGCCTGCAAATGG + Intergenic
979302799 4:119106752-119106774 ACCCAGGACTTGAATGCAAGAGG - Intergenic
979381570 4:120012520-120012542 CATCAGGAGTTGCCTGCCAAGGG + Intergenic
981895570 4:149795507-149795529 CACTAGGACTTGCCTAAATGTGG - Intergenic
982025325 4:151247647-151247669 CAGCAGGGATTGACTGCAAGTGG - Intronic
985576220 5:674645-674667 CACCAGGACCTGCCAGCAGCTGG + Intronic
985631629 5:1017120-1017142 CACCAGGACGTGCCTGGACATGG + Intronic
985778762 5:1858706-1858728 CACCAGGACGTGCCGGAAAGAGG + Intergenic
986851130 5:11815834-11815856 CCCCAAGACTTGCTAGCAAGTGG + Intronic
987988374 5:25179628-25179650 CACCAGGCCTGCCTTGCAAGAGG - Intergenic
990579131 5:57151259-57151281 CACTAGGACTTGCCTAGGAGTGG + Intergenic
991627446 5:68618652-68618674 CAACAGGCCTTGCCTGCTAGTGG + Intergenic
992650695 5:78856375-78856397 AACCAGGACTTGTTTTCAAGGGG - Intronic
993267384 5:85743747-85743769 CACCACCACTGGCCTACAAGGGG - Intergenic
996181469 5:120425386-120425408 CACCAGGCCTGCCCTACAAGAGG - Intergenic
996253628 5:121370123-121370145 CACCATGTCTGGCCTGCATGTGG + Intergenic
996535535 5:124573205-124573227 CACCAGGAGTTTGCTCCAAGTGG - Intergenic
999373288 5:151069128-151069150 CACAAGTGCTTGCCTGCTAGTGG - Intronic
999936000 5:156486433-156486455 CACCTGTACATGCCTTCAAGGGG + Intronic
999936051 5:156486695-156486717 CACCTGCACTTGCCTTCCAGGGG + Intronic
1000147364 5:158466544-158466566 CACCTGCATTTGCCTGAAAGAGG - Intergenic
1002573147 5:180155433-180155455 CACCTGGCCTTGCCTTCAGGAGG + Intronic
1002633410 5:180595548-180595570 CACCTGGCCTGGCCTTCAAGGGG - Intergenic
1003363097 6:5447279-5447301 CACCAGGCTTTGTGTGCAAGGGG + Intronic
1005037492 6:21570115-21570137 CACCAGCACTTGCCTGGGAATGG + Intergenic
1005121303 6:22392117-22392139 CACCACGCCTTGCCAGCATGAGG + Intergenic
1006830227 6:36963953-36963975 CACCAGGCCTTGCCTTTGAGTGG - Exonic
1007637185 6:43306563-43306585 CACCAGCACCTGCCTGCATATGG + Intronic
1010331497 6:74628281-74628303 CACCAGGCCTGCCCTGCAAGAGG + Intergenic
1011689356 6:89852149-89852171 CAACAGTAGTTGCCTGCAGGAGG + Intronic
1012238484 6:96845361-96845383 CACCAGACCTGCCCTGCAAGAGG + Intergenic
1012692005 6:102326226-102326248 CACCAGATCTTCCCTACAAGAGG - Intergenic
1013976794 6:116088216-116088238 GACAAGGACTTGGCTGCAGGTGG - Intergenic
1019256805 7:57525-57547 TACCAGGAATGGCCAGCAAGAGG - Intergenic
1019649152 7:2147250-2147272 CCCCAGGACCTGCAGGCAAGAGG + Intronic
1019799030 7:3074126-3074148 GACCAGGACTTGTCTGCTGGTGG - Intergenic
1025748531 7:64269755-64269777 CACCATGCCTTGCCTGCCAGCGG + Intergenic
1028337247 7:89673116-89673138 CACCAGGCCTGTCCTACAAGAGG - Intergenic
1029671182 7:102032215-102032237 CACCACGCCTGGCCTGGAAGTGG + Intronic
1030701363 7:112645269-112645291 CAGCAGGCCTTCCCTGCAAGAGG - Intergenic
1033658845 7:143390379-143390401 CACTAGGACCTTCCTGCAAGAGG - Intronic
1035430695 7:158818553-158818575 CACCAGGACTTGCCTGCAAGCGG + Intronic
1037307976 8:17525761-17525783 AACCAGCACATTCCTGCAAGCGG + Intronic
1038236991 8:25769062-25769084 CAGCAGGAATGGCCTGCTAGGGG - Intergenic
1044156846 8:88858804-88858826 CACCAGGCCTGCCCTACAAGAGG - Intergenic
1045020586 8:98040326-98040348 CATCAAAACTTGCCTGAAAGAGG + Intronic
1045248674 8:100465343-100465365 CTCCAGGACCTGTTTGCAAGTGG + Intergenic
1046915326 8:119672946-119672968 CACCACGGCTCGACTGCAAGCGG - Intronic
1048741711 8:137567950-137567972 CATCAGTACTTCCCTGCATGGGG - Intergenic
1051917365 9:22224505-22224527 CACCAGGACTGCCCTAAAAGAGG - Intergenic
1059027308 9:110648923-110648945 CACCTGGCTTTGCCTGCAAGGGG + Intergenic
1061489569 9:130937772-130937794 CACCTGGGCTGGCCAGCAAGGGG - Intronic
1061873748 9:133534032-133534054 CTCCAGGCCTGGCCTGCCAGGGG + Intronic
1062077358 9:134598108-134598130 GGCCAGGACCTGCCTGAAAGAGG - Intergenic
1189396725 X:40629449-40629471 GAATAGGACTTGCCTGCCAGTGG + Exonic
1189481302 X:41394247-41394269 CACAAGGACTTGGGTGCAGGTGG - Intergenic
1190992696 X:55568169-55568191 CACCAGGCCTGCCTTGCAAGAGG + Intergenic
1191037514 X:56042990-56043012 CACCAGGCCTGCCTTGCAAGAGG - Intergenic
1195515987 X:105776671-105776693 CACCAAGACTAGCATGCAATGGG + Intergenic
1198367847 X:135959970-135959992 CAGCATGCCTTTCCTGCAAGAGG - Intergenic
1198672512 X:139096141-139096163 GACAAGGATTTGCCTTCAAGAGG + Intronic
1200598770 Y:5181092-5181114 CACCAGGCCTACCTTGCAAGAGG - Intronic