ID: 1035434363

View in Genome Browser
Species Human (GRCh38)
Location 7:158848514-158848536
Sequence GTTAAAGGACTCGCCCCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035434358_1035434363 9 Left 1035434358 7:158848482-158848504 CCAAAAAAGCAAAATGGCAAAGG No data
Right 1035434363 7:158848514-158848536 GTTAAAGGACTCGCCCCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035434363 Original CRISPR GTTAAAGGACTCGCCCCAGA AGG Intergenic
No off target data available for this crispr