ID: 1035435550

View in Genome Browser
Species Human (GRCh38)
Location 7:158856699-158856721
Sequence CCGGGCGGCCGCGGTGTCCT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 204}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035435550_1035435571 29 Left 1035435550 7:158856699-158856721 CCGAGGACACCGCGGCCGCCCGG 0: 1
1: 0
2: 2
3: 17
4: 204
Right 1035435571 7:158856751-158856773 GTCGGTGCGGCGCTGGGTCTGGG 0: 1
1: 0
2: 1
3: 8
4: 69
1035435550_1035435563 7 Left 1035435550 7:158856699-158856721 CCGAGGACACCGCGGCCGCCCGG 0: 1
1: 0
2: 2
3: 17
4: 204
Right 1035435563 7:158856729-158856751 GGAAGCGATGGAGCCCGGGAAGG 0: 1
1: 0
2: 0
3: 25
4: 352
1035435550_1035435570 28 Left 1035435550 7:158856699-158856721 CCGAGGACACCGCGGCCGCCCGG 0: 1
1: 0
2: 2
3: 17
4: 204
Right 1035435570 7:158856750-158856772 GGTCGGTGCGGCGCTGGGTCTGG 0: 1
1: 0
2: 0
3: 11
4: 156
1035435550_1035435562 3 Left 1035435550 7:158856699-158856721 CCGAGGACACCGCGGCCGCCCGG 0: 1
1: 0
2: 2
3: 17
4: 204
Right 1035435562 7:158856725-158856747 TGCGGGAAGCGATGGAGCCCGGG 0: 1
1: 0
2: 1
3: 12
4: 203
1035435550_1035435561 2 Left 1035435550 7:158856699-158856721 CCGAGGACACCGCGGCCGCCCGG 0: 1
1: 0
2: 2
3: 17
4: 204
Right 1035435561 7:158856724-158856746 CTGCGGGAAGCGATGGAGCCCGG 0: 1
1: 0
2: 0
3: 10
4: 165
1035435550_1035435568 22 Left 1035435550 7:158856699-158856721 CCGAGGACACCGCGGCCGCCCGG 0: 1
1: 0
2: 2
3: 17
4: 204
Right 1035435568 7:158856744-158856766 CGGGAAGGTCGGTGCGGCGCTGG 0: 1
1: 0
2: 0
3: 13
4: 136
1035435550_1035435569 23 Left 1035435550 7:158856699-158856721 CCGAGGACACCGCGGCCGCCCGG 0: 1
1: 0
2: 2
3: 17
4: 204
Right 1035435569 7:158856745-158856767 GGGAAGGTCGGTGCGGCGCTGGG 0: 1
1: 0
2: 0
3: 5
4: 104
1035435550_1035435565 16 Left 1035435550 7:158856699-158856721 CCGAGGACACCGCGGCCGCCCGG 0: 1
1: 0
2: 2
3: 17
4: 204
Right 1035435565 7:158856738-158856760 GGAGCCCGGGAAGGTCGGTGCGG 0: 1
1: 1
2: 2
3: 22
4: 270
1035435550_1035435558 -5 Left 1035435550 7:158856699-158856721 CCGAGGACACCGCGGCCGCCCGG 0: 1
1: 0
2: 2
3: 17
4: 204
Right 1035435558 7:158856717-158856739 CCCGGGCCTGCGGGAAGCGATGG 0: 1
1: 0
2: 4
3: 19
4: 202
1035435550_1035435564 11 Left 1035435550 7:158856699-158856721 CCGAGGACACCGCGGCCGCCCGG 0: 1
1: 0
2: 2
3: 17
4: 204
Right 1035435564 7:158856733-158856755 GCGATGGAGCCCGGGAAGGTCGG 0: 1
1: 0
2: 0
3: 15
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035435550 Original CRISPR CCGGGCGGCCGCGGTGTCCT CGG (reversed) Exonic