ID: 1035438492

View in Genome Browser
Species Human (GRCh38)
Location 7:158877557-158877579
Sequence ATGATGCCCAGCTCCTGCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 182}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035438492_1035438494 28 Left 1035438492 7:158877557-158877579 CCTAAGCAGGAGCTGGGCATCAT 0: 1
1: 0
2: 2
3: 20
4: 182
Right 1035438494 7:158877608-158877630 TCAGAAGAAAATGGCATTTCTGG No data
1035438492_1035438495 29 Left 1035438492 7:158877557-158877579 CCTAAGCAGGAGCTGGGCATCAT 0: 1
1: 0
2: 2
3: 20
4: 182
Right 1035438495 7:158877609-158877631 CAGAAGAAAATGGCATTTCTGGG No data
1035438492_1035438493 19 Left 1035438492 7:158877557-158877579 CCTAAGCAGGAGCTGGGCATCAT 0: 1
1: 0
2: 2
3: 20
4: 182
Right 1035438493 7:158877599-158877621 TCATTTGATTCAGAAGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035438492 Original CRISPR ATGATGCCCAGCTCCTGCTT AGG (reversed) Intronic
900791583 1:4684337-4684359 ATGAGGCTCACCTCCTGCCTGGG + Intronic
904075703 1:27840580-27840602 GTGATGTCCAGCTCCTGCTTTGG + Intronic
905120646 1:35679296-35679318 AGGATCCCCAGCTTCTGCTCAGG - Intergenic
907250397 1:53134269-53134291 TTGCTGCCCTGCTCCTGCTGTGG - Intronic
908136793 1:61141370-61141392 ATGATGCCCGGTTTCTGGTTTGG - Intronic
909988665 1:82194292-82194314 ATGATGCCCAGTTTCTGCCTTGG - Intergenic
910163136 1:84295468-84295490 ATGATGCCCAGCTCCATCAGAGG + Intergenic
910208977 1:84774913-84774935 ATAAAGCCCAGCATCTGCTTGGG - Intergenic
912776541 1:112509288-112509310 AAGCTGCGCAGCTCCCGCTTCGG + Exonic
916574522 1:166055439-166055461 AGTATGCCCGGCTTCTGCTTGGG + Intergenic
916576324 1:166070286-166070308 ATGATGCCCAGGTCCTCATGTGG - Exonic
917826697 1:178829356-178829378 CTGCTGCCCACCTCCTGCTGTGG - Intronic
918216613 1:182397294-182397316 CTTATCCCCAGCTCTTGCTTTGG + Intergenic
920305479 1:205015589-205015611 ATCATGCCCAGCCCCTTCTGAGG - Intronic
920611309 1:207440431-207440453 CTGATGCCTAGCTGCTGGTTAGG - Intergenic
920611358 1:207441006-207441028 CTGATGCCTAGCTGCTGGTTAGG + Intergenic
921040822 1:211430190-211430212 ATGATCCCCAGATCAGGCTTGGG - Intergenic
922860228 1:228810243-228810265 AAGTTGCCAAGCTACTGCTTAGG - Intergenic
924696635 1:246407328-246407350 ATGATGAACAACTCCTGCTAAGG - Intronic
924727814 1:246686485-246686507 CTCATGCCCAGCTCCATCTTGGG + Intergenic
1063671837 10:8105373-8105395 ATGAGGTCCAGCACCTTCTTAGG + Intergenic
1063934543 10:11064061-11064083 ATGATTCCCAGCATCTGCTTGGG + Intronic
1066870156 10:40493469-40493491 ATGATGCTGAACTCCTGCCTGGG - Intergenic
1069679021 10:70270576-70270598 ATGATGCCCAGGCTCTGCTGAGG - Intronic
1072683261 10:97521729-97521751 CTGCTGCCCAGCTGCTGCTGGGG - Intronic
1075038760 10:119091032-119091054 ATGAAGTGCAGCTCCTGCTTGGG + Intergenic
1075463028 10:122631369-122631391 ACAATGACCAGCTCCTGCCTGGG - Intronic
1076234993 10:128856595-128856617 ATGCTGCCCTGCTCCTGCCCAGG + Intergenic
1078510248 11:11979550-11979572 TTCCTGCCCAGCTCCTGCTAAGG + Intronic
1081256221 11:40898839-40898861 ATGATGGCCAGCATGTGCTTAGG - Intronic
1083587330 11:63869831-63869853 ACGATGCCCACTTCCTGCTGTGG + Intronic
1084392928 11:68890514-68890536 ATGATGCCAGGCCCCTGGTTTGG - Intergenic
1085528271 11:77176529-77176551 CTGATGCCCAGCCCCTGTGTGGG + Intronic
1087964413 11:104394582-104394604 ATGATGCACATCTGCTGCTCAGG - Intergenic
1088842862 11:113641404-113641426 TTGCTGGCCAGCTCCTGGTTAGG - Intergenic
1089203682 11:116740992-116741014 AGGATGGCCGTCTCCTGCTTTGG - Intergenic
1096185370 12:49576985-49577007 ATGATGCCCAGTTCAGGCTTTGG + Intronic
1101337180 12:103807151-103807173 ATGAGGCCCAGCCTGTGCTTGGG - Intronic
1101513583 12:105414227-105414249 ATGCAGCCCAGCTCCAGCCTTGG - Intergenic
1101612025 12:106301789-106301811 CTGCTGCTCAGCTCCTGCTGTGG - Intronic
1104555361 12:129795175-129795197 ATGATGACCAGCTCCTGGAAGGG - Intronic
1105538540 13:21293226-21293248 GTGTTGCCCAGCTCCTTCCTGGG - Intergenic
1108524167 13:51271830-51271852 ATGATGCCCAGCTGCAGTCTGGG + Intronic
1109181175 13:59215791-59215813 ATGCTGGCAAGTTCCTGCTTCGG + Intergenic
1110416196 13:75255535-75255557 ATAATGCCCAGCTCGTATTTAGG - Intergenic
1112664782 13:101557082-101557104 CTGATGCACAGCTCCTGCTGGGG + Intronic
1113720675 13:112553606-112553628 AGGATTCCCATCTCCAGCTTCGG + Intronic
1117949027 14:61062118-61062140 ACGATGCCCAGCCCCTGTGTAGG + Intronic
1118756469 14:68848323-68848345 CTGATTTTCAGCTCCTGCTTTGG - Intergenic
1119226398 14:72947638-72947660 AGGAAGCCCAGCTCCTCCTGAGG + Intronic
1119419816 14:74501853-74501875 ACAATGCCCGGCTCCTGCTGGGG + Intronic
1119919091 14:78429591-78429613 AAGATGATCAGCACCTGCTTTGG + Intronic
1122860747 14:104581359-104581381 AGGAGGCCCAGCTCCTCCTGGGG + Intronic
1124689175 15:31807547-31807569 AAGATCCCCAGCTCCAGTTTTGG + Intronic
1125545288 15:40498937-40498959 AGGATGCCCAGCCCCTGCTTAGG + Intergenic
1131771184 15:95739330-95739352 ACGATGCTCAAATCCTGCTTTGG - Intergenic
1135089302 16:19500168-19500190 ACCATGCCCGGCTGCTGCTTGGG + Intergenic
1135101992 16:19613893-19613915 ATGATTCCCATCTGCTGTTTCGG - Intronic
1137060705 16:35789895-35789917 ATTCTGGCCAGCTCCTACTTTGG - Intergenic
1140056676 16:71531565-71531587 AGGAGGCCCAGCTCCAGCTTGGG + Intronic
1142576372 17:911200-911222 ATCATGCCCTGCCCCTGCTTGGG + Exonic
1144155791 17:12499989-12500011 ATGTTGCCCAGGTCCTGCCTTGG - Intergenic
1145002519 17:19315190-19315212 GTTATGCCCAGCCCCTCCTTTGG + Intronic
1146677788 17:34785363-34785385 TTGGAGCCCAGCTCCTGCTCAGG - Intergenic
1147735674 17:42636454-42636476 ATGAGCTCCAGGTCCTGCTTAGG + Intergenic
1148291436 17:46454338-46454360 ATGATGCCCAGCACCTACTATGG - Intergenic
1148313624 17:46672040-46672062 ATGATGCCCAGCACCTACTATGG - Intronic
1148539941 17:48472417-48472439 AGGCAGCCCAGCTCCTGCTAAGG + Intergenic
1150626484 17:66844689-66844711 ATGATGACAAGTTCCTACTTTGG + Intronic
1152744326 17:82032005-82032027 ATGCTGCCCGGCTCCCGCTTGGG + Intronic
1153536153 18:6104044-6104066 AGGTGGCCCAGCTCCTCCTTGGG + Intronic
1153916847 18:9753410-9753432 GTGATGCCCTGCTCCACCTTGGG + Intronic
1156308923 18:35904958-35904980 GGGCTGCCCAGCTTCTGCTTGGG + Intergenic
1157161662 18:45319136-45319158 ATGAGCCCCAGCTCCTCTTTAGG + Intronic
1158134972 18:54198136-54198158 CTGATGACCAGCTCCTGGTAGGG - Intronic
1158586960 18:58747595-58747617 ATAATGCCCTGCTCCTCCTGAGG - Exonic
1159375223 18:67584391-67584413 ATTATTACCAGCTCCTGCCTGGG + Intergenic
1159764400 18:72470367-72470389 ATGATGCCCCACTCCTGTCTTGG + Intergenic
1162717965 19:12645777-12645799 ATAATCCCCAGCTACTACTTGGG - Intronic
1163860624 19:19740915-19740937 ATGATGTCCCGCTCCTGCGCGGG - Intergenic
1164180591 19:22815002-22815024 ATAATGCAAATCTCCTGCTTGGG + Intergenic
1164846850 19:31439714-31439736 ATGATGCCCAGCCCCTAGCTGGG + Intergenic
1166940327 19:46359458-46359480 ATGAAACCCAGCTTCTGCTTTGG + Intronic
926746006 2:16158927-16158949 ATCCTGCCCAGCACCTGCATTGG + Intergenic
926823604 2:16880382-16880404 ATGACGCTCAGCTCTGGCTTCGG - Intergenic
927242640 2:20932069-20932091 TTGATGCCCAGCTGGTGCTCAGG + Intergenic
930008239 2:46915249-46915271 ATGATGCCCAATTCTGGCTTGGG + Intronic
932743665 2:74313172-74313194 ACTATGCCCAGCTCCTCCTCTGG + Intronic
935669624 2:105543969-105543991 ATGACCCCCAGCTTCTGATTGGG - Intergenic
937014477 2:118591657-118591679 CTGATCCGCAGCTCCTGCTCAGG - Intergenic
937015090 2:118597699-118597721 AGGATGCACAGCCCCTGCTGTGG - Intergenic
937128543 2:119489816-119489838 ATGAGGCCCAGCTCCTGACTTGG - Intronic
937258347 2:120570136-120570158 AAGACGCCCACCTCCTGCTCAGG + Intergenic
938266322 2:129930775-129930797 CTCTGGCCCAGCTCCTGCTTGGG + Intergenic
938280119 2:130057853-130057875 ATGATGCACAGGTACAGCTTGGG - Intergenic
938331076 2:130448568-130448590 ATGATGCACAGGTACAGCTTGGG - Intergenic
938358872 2:130672935-130672957 ATGATGCACAGGTACAGCTTGGG + Intergenic
938435265 2:131279588-131279610 ATGATGCACAGGTACAGCTTGGG + Intronic
938461414 2:131500109-131500131 CTGCTGCCCAGCTCCTTCTGAGG - Intergenic
941713590 2:168740862-168740884 ATAATGACCAACTCCTACTTAGG - Intronic
943635690 2:190304366-190304388 ATGATGCCCTGTACCTCCTTGGG - Intronic
943685466 2:190813187-190813209 TTCATGCCCAGCTCATGGTTGGG + Intergenic
944075993 2:195731321-195731343 CTCATGGCTAGCTCCTGCTTAGG + Intronic
948805436 2:240451890-240451912 AAGCTGCCCAGATCCTGCTTGGG - Intronic
948834769 2:240620618-240620640 GTGGTGCCCAGCTCCTGCCAAGG + Intronic
1170443991 20:16406093-16406115 ATGATGCCCAGTTCCTTGGTGGG + Intronic
1170874494 20:20237393-20237415 ATCTTGCCCAGCTCCACCTTGGG - Intronic
1171156653 20:22880638-22880660 ACATTCCCCAGCTCCTGCTTCGG - Intergenic
1175441304 20:58994101-58994123 ATGACGTCCAGCACCTGCGTGGG - Exonic
1176843187 21:13856699-13856721 AAGATGCACAGCTACAGCTTGGG - Intergenic
1176845875 21:13876045-13876067 AAGATGCACAGCTACAGCTTGGG - Intergenic
1176848610 21:13895600-13895622 AAGATGCACAGCTACAGCTTGGG - Intergenic
1178747765 21:35269725-35269747 ATGATGACTACCTCATGCTTGGG - Intronic
1178824079 21:36000849-36000871 AAGATGCTCAGCGCCTTCTTGGG + Intronic
1179053945 21:37914715-37914737 GTGATGCCCAGGAACTGCTTAGG - Intronic
1179712004 21:43268855-43268877 ATGAGGCTCCGCTGCTGCTTGGG + Intergenic
1180963021 22:19770889-19770911 CTGGTGCCCAGCTCCTGGTTGGG - Intronic
1181688872 22:24547176-24547198 CTGCTTCCCTGCTCCTGCTTAGG - Intronic
1182585264 22:31341281-31341303 AGCATGCCCAGCTCCTCCCTGGG - Intronic
1183365103 22:37402809-37402831 ACGAGGCCCAGCTCATGCTCTGG - Intronic
1185111425 22:48902254-48902276 AAGAGGCCCAGCTCCTGTTTGGG + Intergenic
949935437 3:9112219-9112241 AGGAAGGCAAGCTCCTGCTTGGG + Intronic
950798726 3:15532143-15532165 AAGATGGCCAGCTCCTCTTTGGG + Intergenic
952828888 3:37546628-37546650 ATGCTGCCTGACTCCTGCTTTGG + Intronic
953659502 3:44881519-44881541 GTGATGCCCAGCACCACCTTGGG - Intronic
955387937 3:58493845-58493867 TTTATGCCCAGCTTCTTCTTTGG - Intronic
961034647 3:123634150-123634172 ATGATGCACAGCTCTTCCTGTGG - Intronic
961381522 3:126498972-126498994 ATGAAGCCCAGCACCTGCTGTGG - Intronic
962978705 3:140468708-140468730 ATTATGCCCGGCTGCTGCTTTGG + Intronic
963222214 3:142825278-142825300 AACATGCCCTTCTCCTGCTTTGG + Intronic
965693856 3:171386050-171386072 ATGGAGCCCAGCTTCAGCTTTGG - Intronic
966214603 3:177489646-177489668 ATGATGCCCTGCGCCACCTTAGG - Intergenic
966310258 3:178586242-178586264 ATTATTTCCACCTCCTGCTTAGG - Intronic
967728886 3:192888325-192888347 ATGATTCCCAGCTCTTGCCTGGG - Intronic
968267234 3:197371516-197371538 CTGACTCCCAGCTGCTGCTTAGG + Intergenic
968867945 4:3225702-3225724 ATGCTCCCCAGCTCCCGCTCGGG - Exonic
969432774 4:7165735-7165757 CCGATGCCCTCCTCCTGCTTGGG + Intergenic
972776932 4:42250073-42250095 CTGGTGTCCAGCTCCTGCTAAGG - Intergenic
974620799 4:64350995-64351017 ATGATCTCCAGTTCCTCCTTTGG - Intronic
978867134 4:113526853-113526875 AAAATGCCCAGATCCTGCATGGG - Intronic
982931602 4:161415207-161415229 ATGCTGCCCACCCCCAGCTTGGG + Intronic
985196699 4:187437969-187437991 ATGAGTCACAGCTCCAGCTTGGG + Intergenic
985484941 5:143196-143218 CTGACGTCCAGCACCTGCTTGGG - Exonic
986201575 5:5584045-5584067 TTGAAGCCCAGCATCTGCTTGGG - Intergenic
987042290 5:14074309-14074331 ATGATGCCCAGGACATGCCTTGG - Intergenic
988788271 5:34584122-34584144 ATGATGCCCTGCACCACCTTGGG - Intergenic
990153539 5:52847920-52847942 ATGGTGCCAAATTCCTGCTTTGG - Intronic
990624453 5:57595857-57595879 ATTATGCACAGCAGCTGCTTGGG + Intergenic
993058807 5:83014500-83014522 ATAATGCCCAGTTGCTTCTTTGG - Intergenic
995086036 5:108110212-108110234 ATTATGCTCAGGTTCTGCTTGGG - Intronic
996836096 5:127794241-127794263 ATGATGACCAGGGCCTACTTTGG + Intergenic
999819427 5:155210731-155210753 ATGATGCCTAGAACCTGTTTTGG - Intergenic
1001986413 5:176077070-176077092 ATGATTCCAACCTCCTGCTGTGG + Intronic
1002230454 5:177761055-177761077 ATGATTCCAACCTCCTGCTGTGG - Intronic
1002264882 5:178022692-178022714 ATGATTCCAACCTCCTGCTGTGG + Intronic
1004192156 6:13473274-13473296 AGGGTGCCCAGCCCCTGGTTTGG - Intronic
1006028027 6:31159605-31159627 ATGAGGCCAGGCTCCTGCTGGGG - Exonic
1006394445 6:33777949-33777971 GTGGGGCCCAGCTCCTGCTCAGG + Intronic
1011092665 6:83623680-83623702 ATTATGCCCAGCTTCTGGATAGG + Intronic
1011195518 6:84775056-84775078 ATGGGGCACAGCTCCTGCTCCGG - Intergenic
1011838509 6:91465514-91465536 CTGGTGCCCAGTTCCTACTTTGG - Intergenic
1011853291 6:91657349-91657371 CTGATGCACATATCCTGCTTTGG + Intergenic
1014581450 6:123142367-123142389 ATGAATACCAGCACCTGCTTTGG - Intergenic
1016497105 6:144675863-144675885 CTAATGCACAGCTCCTGCTTAGG - Intronic
1017714396 6:157198590-157198612 ATGGTGCCAAGCTCCTAGTTTGG - Intronic
1019720818 7:2569495-2569517 ATGCTGCCCTCCTCCTGCTGAGG - Intronic
1019820094 7:3236206-3236228 AAGCTGTCCAGCTTCTGCTTGGG + Intergenic
1020089710 7:5332447-5332469 CAGGTGCCCAGCTCCTGCTGTGG + Intronic
1020152243 7:5691594-5691616 AAAATGCCCAGCTTCTCCTTAGG + Intronic
1021084702 7:16408488-16408510 ATACTGCCCACCTCCTGCCTGGG - Intronic
1021627088 7:22603937-22603959 ATGGTGCCCAGCAGATGCTTGGG - Intronic
1022353917 7:29593035-29593057 ATGATGTCCAGCTCTTACTGGGG - Intergenic
1023139902 7:37091478-37091500 AAGATGCCCAGCTCCTAGCTGGG - Intronic
1023283511 7:38595159-38595181 ACGCTGCCCCGCCCCTGCTTTGG + Intronic
1027876928 7:83782722-83782744 ATGCTGTCCAGCACTTGCTTTGG - Intergenic
1028825192 7:95264244-95264266 ATGATGCTCAGCACCTCCATTGG + Intronic
1032657962 7:133952340-133952362 AGGATGCCCAGCTGAAGCTTGGG - Intronic
1034720394 7:153286878-153286900 ATGCCGACCAGCTCCTGCTCAGG - Intergenic
1035438492 7:158877557-158877579 ATGATGCCCAGCTCCTGCTTAGG - Intronic
1038042910 8:23741317-23741339 ATGATGCCCAGCTCATGGCAAGG - Intergenic
1040382981 8:46891122-46891144 ATGATGCTCCTCTTCTGCTTGGG - Intergenic
1042522134 8:69724808-69724830 CTGACTCCCAGCTCCTGCTGCGG - Intronic
1045152159 8:99420679-99420701 ACTATGCTCAGCTCCTCCTTTGG + Intronic
1047511212 8:125517203-125517225 ATGATGGGCAGCCCTTGCTTGGG - Intergenic
1048065374 8:130962318-130962340 ACGATTCCCAACTCCTGCTGGGG + Intronic
1050560484 9:6829821-6829843 TGGAAGCCCAGTTCCTGCTTTGG + Intronic
1053068863 9:35088892-35088914 ATGATCCCTAACTCCTGATTTGG - Exonic
1054863589 9:69977268-69977290 AAGGTGCCCAGCTCCATCTTGGG - Intergenic
1055599179 9:77897600-77897622 GTTTTGCCCAGGTCCTGCTTTGG - Intronic
1055804963 9:80082372-80082394 ATGAAGCTCAGGTCCTGCCTAGG - Intergenic
1056434531 9:86562732-86562754 ATGCTGCCCAGCTCTCCCTTAGG + Intergenic
1057746925 9:97759857-97759879 CTGCTTCCCAGCCCCTGCTTGGG - Intergenic
1057818581 9:98314210-98314232 ATGCAGCCCAGCTCCTGGGTGGG - Intronic
1058143398 9:101382404-101382426 ATGGTGCCCTGCTTGTGCTTGGG - Intronic
1058364456 9:104191569-104191591 AACATGCCAAGCTCCTGCTATGG - Intergenic
1059276013 9:113097802-113097824 AAGATGCCCAGTTCTTGCTATGG + Intergenic
1059493890 9:114693581-114693603 ATGTTGCTCAACTCCTGCCTGGG - Intergenic
1060361262 9:122959751-122959773 ATGATATCTTGCTCCTGCTTTGG - Intronic
1060716639 9:125936646-125936668 ATGATTTCCAGCTCCTCTTTTGG + Intronic
1060780611 9:126409575-126409597 GGGATGCCCTGCTCATGCTTAGG - Intronic
1062439580 9:136563727-136563749 TTGAAGCCCAGCTCCTGCCAGGG - Intergenic
1187244930 X:17545551-17545573 ATGTAGTCCAGCTCCTGCCTGGG + Intronic
1192174856 X:68879271-68879293 ATGGTGCCCAGCTCCTGGGAGGG - Intergenic
1192405416 X:70880882-70880904 ATCCTGCCCAGCTAATGCTTGGG - Intronic
1200125914 X:153814787-153814809 ATGATGCCCAGCACGTGGTCAGG - Intronic