ID: 1035441082

View in Genome Browser
Species Human (GRCh38)
Location 7:158900667-158900689
Sequence ATTCACATGTATAATGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 229}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035441082_1035441087 6 Left 1035441082 7:158900667-158900689 CCATCCCCATTATACATGTGAAT 0: 1
1: 0
2: 0
3: 17
4: 229
Right 1035441087 7:158900696-158900718 TGCAGTTGTCCCACAGTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035441082 Original CRISPR ATTCACATGTATAATGGGGA TGG (reversed) Intronic
904825006 1:33268636-33268658 ATTCACTAGTGAAATGGGGAGGG + Intronic
905458683 1:38106559-38106581 AGTCACCTGTAAACTGGGGATGG + Intergenic
907100595 1:51830647-51830669 ATTCCCGCTTATAATGGGGAGGG + Intronic
907975242 1:59425434-59425456 CTTCACAAGTGTAATGGGAAGGG - Intronic
909852106 1:80480383-80480405 CCTCACCTGTATAATGGGGTTGG - Intergenic
910487781 1:87734341-87734363 ATTCAAATATATAATAGGTACGG + Intergenic
910497498 1:87848634-87848656 CTTCACATGTCTAAAGGGTATGG - Intergenic
911587977 1:99713189-99713211 ACTCACCTGTAAAATGGGGGTGG - Intronic
912997475 1:114545648-114545670 TTTCAAATGAATATTGGGGAGGG - Intergenic
913577181 1:120188088-120188110 ATTCACATGCAAAATGATGATGG + Intergenic
914559094 1:148799523-148799545 ATTCACATGCAAAATGATGATGG + Intergenic
914613739 1:149330706-149330728 ATTCACATGCAAAATGATGATGG - Intergenic
917291179 1:173473927-173473949 AGTGAGATGTATAATGGGAAAGG - Intergenic
917698506 1:177555471-177555493 ATTCAAAGGTGCAATGGGGAGGG + Intergenic
918592043 1:186250868-186250890 ATTCCCATGTGTTGTGGGGAGGG - Intergenic
918920398 1:190702347-190702369 ACTCAAGTGTATAGTGGGGATGG - Intergenic
919167676 1:193916629-193916651 ATTTACATGTAAAAGGGGTAGGG - Intergenic
919656954 1:200206472-200206494 ACTCGTATGTATGATGGGGAAGG - Intergenic
919656961 1:200206523-200206545 ACTCATATGTATGATGGGGAAGG - Intergenic
920303684 1:205005225-205005247 ATTAACAAATATAACGGGGATGG - Intronic
921972226 1:221162567-221162589 ATTGTGTTGTATAATGGGGATGG - Intergenic
1063001646 10:1929808-1929830 CTTCACACGTAGAGTGGGGATGG + Intergenic
1065359335 10:24874827-24874849 ATTCCCATGTGTCATGGGGAGGG + Intronic
1068084136 10:52353473-52353495 ATTCATCTATATAATAGGGATGG + Intergenic
1069260823 10:66393979-66394001 TTCCAAATGTATAATGGGAAGGG + Intronic
1069384042 10:67868301-67868323 TTTCACATATATAAAGTGGAGGG - Intergenic
1069542588 10:69306530-69306552 GTTCACATGTGAAATGAGGAGGG + Intronic
1070402937 10:76069237-76069259 TTTCACAAGCATGATGGGGAAGG + Intronic
1070466583 10:76730164-76730186 ATGCAAATGTATAATGGGATAGG - Intergenic
1070563583 10:77586680-77586702 ATTAACATGTTTTATGTGGAGGG - Intronic
1071465508 10:85936048-85936070 ATACACAGGTATAATGGTGTAGG + Intronic
1072733378 10:97863224-97863246 CCTCACCTGTAAAATGGGGATGG + Intronic
1074459452 10:113624137-113624159 ATTCACATGCAGAAAGGGAAAGG - Intronic
1074762066 10:116674672-116674694 ATTCACATGGGCAATGGTGAGGG + Exonic
1074899493 10:117803999-117804021 ATTCACATGTATGATTGCGTGGG - Intergenic
1075909041 10:126107704-126107726 ATTCTCATGTGCAATGTGGATGG - Intronic
1076046917 10:127301588-127301610 AATCAAATGTATTATGGGCAAGG + Intronic
1077561211 11:3262726-3262748 CTTCACATGACTAATGGAGAAGG - Intergenic
1077567105 11:3308555-3308577 CTTCACATGACTAATGGAGAAGG - Intergenic
1078974697 11:16459861-16459883 ATATACATGTATAATATGGAGGG + Intronic
1079372986 11:19867975-19867997 GGTCACATGTATACTGTGGAAGG + Intronic
1079796437 11:24809286-24809308 ATTCACATGTGGAGTGGGAAGGG + Intronic
1080216116 11:29843134-29843156 ATTTACATGTATAAAGTGGTAGG + Intergenic
1082852969 11:57781718-57781740 AGGCACATGGATAATGGGGGAGG + Intronic
1083116648 11:60466316-60466338 CTTCAACTGTAAAATGGGGATGG + Intronic
1083120138 11:60504045-60504067 AATCACATGAACAATGGGGAAGG + Intronic
1084522556 11:69673307-69673329 CTTCACAGGTTTCATGGGGAAGG - Exonic
1088164947 11:106923656-106923678 ATTGACATATAAAAGGGGGATGG + Intronic
1091904834 12:4176792-4176814 ATTAAAATGTATAATGTGAAAGG - Intergenic
1092035353 12:5329724-5329746 ATTCACCTGAAAAATGAGGAGGG + Intergenic
1092930806 12:13314029-13314051 TTTCCCATGTCTAATGGGAATGG - Intergenic
1097180727 12:57170295-57170317 ATTCACAGGTATTATGGGATAGG + Intronic
1097263262 12:57731550-57731572 ACTCACCTGTTTGATGGGGATGG + Exonic
1097454669 12:59783173-59783195 TTTCATATGTAGAATGTGGAAGG + Exonic
1097883888 12:64709939-64709961 ACTCACATATATAATGAGGTGGG + Intergenic
1098505360 12:71243148-71243170 TTTCACATGTAAAAAGAGGAGGG - Intronic
1098613048 12:72485580-72485602 CCTCACCTGTAGAATGGGGAGGG - Intronic
1099333730 12:81327273-81327295 ATTCACATGTTTAATGAATACGG + Intronic
1100151567 12:91743893-91743915 ATGCACATGTATCATGCCGAGGG + Intergenic
1100803941 12:98261650-98261672 AATCCCCTGTAGAATGGGGAGGG + Intergenic
1101866600 12:108524928-108524950 ATTAACCTGGATAAAGGGGAGGG + Intronic
1103127592 12:118437543-118437565 ATACACATGGATATTGGGGTCGG - Intergenic
1103481366 12:121252199-121252221 ATACACATGTATATTTAGGAAGG + Intronic
1103964382 12:124629351-124629373 ATTCACCTGTGTATTGGGTATGG + Intergenic
1104048360 12:125179728-125179750 TTGCACATGTATAATGGTGCAGG + Intergenic
1104377835 12:128280543-128280565 AATCACTAGAATAATGGGGACGG + Intronic
1107153697 13:37141781-37141803 ATTCCCACATATCATGGGGAAGG + Intergenic
1108868223 13:54948120-54948142 ATTCCCATGTGTTGTGGGGAGGG + Intergenic
1110585670 13:77188520-77188542 CTTCATGTGTACAATGGGGATGG + Intronic
1111390299 13:87585486-87585508 AATCACATCTATATTGTGGAGGG - Intergenic
1111426070 13:88084752-88084774 ATTGAGATGTATAATGAGGTGGG - Intergenic
1112111493 13:96304618-96304640 AATAACATATATAATGTGGAAGG + Intronic
1112818540 13:103302654-103302676 TTTCATCTGTAAAATGGGGATGG + Intergenic
1113309134 13:109112873-109112895 ATTCACATGTATTAAGGTGAAGG - Intronic
1115426359 14:33264703-33264725 ATTCACATTTATAGTGTGAAAGG - Intronic
1115790035 14:36868201-36868223 ATTCACTTGTATAAATGGGAAGG - Intronic
1117778271 14:59204593-59204615 ATCCACATTTAAAGTGGGGAAGG + Intronic
1120862131 14:89264461-89264483 ATTCCCATGTGTTATGGGAAGGG - Intronic
1121044524 14:90778174-90778196 AGTCACATGTATACTGGGAGAGG - Intronic
1124996500 15:34728068-34728090 ATTTAGATGGAGAATGGGGAGGG - Intergenic
1126540456 15:49816794-49816816 ATACACATGGATAAGGGAGAAGG - Intergenic
1127062871 15:55205372-55205394 ATTCGTAGGTCTAATGGGGATGG + Exonic
1130127985 15:81110432-81110454 ATTCACAGATATCCTGGGGAGGG - Intronic
1130423020 15:83767158-83767180 GTTCACCTGCAAAATGGGGATGG + Intronic
1131763417 15:95649628-95649650 ATTCACAAGTTTAAGGGGCAAGG - Intergenic
1134260200 16:12644990-12645012 CTTCATCTGTAAAATGGGGAAGG - Intergenic
1135773784 16:25238280-25238302 AGTCACAAGTTTAATGGGAAGGG - Exonic
1137823072 16:51464062-51464084 TTTCACTTGTAAAATGGGGAGGG + Intergenic
1139030776 16:62878212-62878234 ATCCCCATGTATCATGGGGAGGG + Intergenic
1139676107 16:68524720-68524742 ATTCAGATATATGTTGGGGAGGG - Intergenic
1142886603 17:2916621-2916643 CTTCACTTGCATAATAGGGACGG + Intronic
1143952139 17:10641684-10641706 TTTCATATGTTTAATGGAGACGG + Intronic
1144715124 17:17429039-17429061 ATTTACATGTAAAATGTGTAAGG + Intergenic
1144765869 17:17732134-17732156 CTTCATCTGTAAAATGGGGATGG - Intronic
1146921024 17:36711756-36711778 TTTCACCTGTGAAATGGGGATGG + Intergenic
1147524717 17:41211032-41211054 ACAAACATGTATAATGGGGTAGG + Intronic
1153487810 18:5618153-5618175 ACTCAGCTGTAAAATGGGGAAGG + Intronic
1153513142 18:5877392-5877414 ATTCACGTGTCTAATGATGAAGG + Intergenic
1156593039 18:38512990-38513012 ATTCCCATGTGTTGTGGGGAGGG + Intergenic
1157172887 18:45424295-45424317 ATCCTCATGTATAAAGGGGTTGG + Intronic
1157651518 18:49337356-49337378 ATCCACATGTATGGAGGGGAGGG - Intronic
1158526862 18:58222503-58222525 ATTCACATGTATGAGTAGGAAGG - Intronic
1161616907 19:5276019-5276041 CCTCACATGTAAAATGGGGATGG - Intronic
925139948 2:1543221-1543243 CTTCACATGTGAAATGAGGACGG - Intronic
925444859 2:3919035-3919057 TTTCATATGTATTTTGGGGAGGG - Intergenic
925764897 2:7223039-7223061 ATTCTCATAAATGATGGGGATGG + Intergenic
925855431 2:8124842-8124864 ATTAACATATATTATGTGGATGG - Intergenic
928938024 2:36700869-36700891 TTTCATCTGTATAATGGTGATGG - Intronic
929894710 2:45949113-45949135 ATATACATGTATACTGAGGAAGG + Intronic
932281372 2:70495358-70495380 ATGCTCATGTAAAATGTGGAGGG - Intronic
932632341 2:73355771-73355793 ATACACAGGTATAATAGAGAAGG - Intergenic
935115409 2:100131335-100131357 ACTCATATATATAATGGAGAGGG - Intronic
935219217 2:100997785-100997807 CCTCCCATGTAGAATGGGGATGG + Intergenic
935294201 2:101634606-101634628 ATTCACATGGAATATTGGGAGGG - Intergenic
936583728 2:113731893-113731915 TTTCACATGTAAAATGGGAATGG - Intronic
937678622 2:124619612-124619634 ATTGACCTCCATAATGGGGATGG + Intronic
937689013 2:124732988-124733010 ATTCACATGAATAATTGCAATGG + Intronic
937780737 2:125834298-125834320 ATTCATATATAAAATAGGGATGG - Intergenic
941497011 2:166218246-166218268 ACTTACATGTAAAATGGGGTGGG + Intronic
942268388 2:174249666-174249688 CCTCACTTGTAAAATGGGGATGG - Intergenic
942500703 2:176587712-176587734 ATTCATTTGTATAATGGAGCTGG - Intergenic
943563528 2:189491231-189491253 ATTCAATTGTAGAATGGGAATGG + Intergenic
944020737 2:195100590-195100612 ATTCATCTGTAAAATGGAGAAGG + Intergenic
944272622 2:197800767-197800789 ATCACCATGTATATTGGGGAGGG + Intergenic
945884066 2:215355927-215355949 ATTCTTCTGTAAAATGGGGATGG + Intergenic
946004628 2:216513030-216513052 ATAGACATGTATTATGGGTATGG + Intronic
1172827484 20:37802766-37802788 ATTTAGATGTATAATGTGTACGG + Intronic
1174167680 20:48596849-48596871 ATTCACATATATAATCGCAAGGG + Intergenic
1174870518 20:54176966-54176988 GTACACATGTATAATGAGGGTGG + Intergenic
1176957738 21:15125905-15125927 ATTCACATGTTTAGTAGAGATGG - Intergenic
1177787883 21:25692022-25692044 ATTTACATACATAATGTGGAAGG + Intronic
1178182965 21:30185530-30185552 ATTAATATATACAATGGGGAAGG + Intergenic
1178627967 21:34233963-34233985 AGTCACATCTATAAGGTGGAAGG - Intergenic
1179934629 21:44594278-44594300 AATCAAATGTAAAGTGGGGAAGG + Intronic
1182096282 22:27628110-27628132 TTTCATCTGTAAAATGGGGATGG - Intergenic
1185103761 22:48855759-48855781 ATTCACATGTCTCATGACGAGGG + Intergenic
951134858 3:19093307-19093329 ATTCACATGAAGAATGGTGGAGG + Intergenic
951977246 3:28526073-28526095 CCTCATATGTAAAATGGGGATGG + Intronic
952937487 3:38411663-38411685 ATTCTCATGTAGAATAGGAAAGG - Intronic
954237671 3:49269403-49269425 ATCCACATGTATTATTTGGAAGG + Exonic
955191846 3:56769107-56769129 ATTCACTTTTATAATGGAAAAGG + Intronic
955691560 3:61595689-61595711 ATTCACATGTAAAACTGGGTTGG + Intronic
956741720 3:72280732-72280754 CTTCATCTGTAAAATGGGGATGG - Intergenic
957710846 3:83857766-83857788 TTTCATATGTAAAATGTGGATGG - Intergenic
962473956 3:135739727-135739749 ATTCAAATGCATAAAGTGGAGGG - Intergenic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
963204612 3:142619871-142619893 ACTCAGAGGTATAATGGGCAAGG + Intronic
964116082 3:153137689-153137711 CTTCACATGGCAAATGGGGAAGG - Intergenic
964384247 3:156130470-156130492 ATGCACATGGATCATTGGGAAGG - Intronic
964890756 3:161531879-161531901 ATACACATGTATATAGGGAAAGG - Intergenic
965475183 3:169147596-169147618 ATCTACATGTTTAAGGGGGATGG - Intronic
967534889 3:190590644-190590666 TTTCACTTGTAAAATGGGAAGGG + Intronic
967614149 3:191545326-191545348 GGTCACATGTATCATGAGGATGG - Intergenic
967873093 3:194248510-194248532 ATTCACAGGTATCATGAGCATGG + Intergenic
968715428 4:2155255-2155277 ATTCACATGGATATTGGTGCTGG + Intronic
970989445 4:22195317-22195339 ATTCTCATCTATACTGGGGAGGG + Intergenic
973002799 4:44972683-44972705 ATTCACATGTATGTTGTGGGGGG + Intergenic
973854929 4:55001910-55001932 TTTCACATGTATACTGGGTAGGG - Intergenic
974087424 4:57276317-57276339 ATTCCCATGTATTGTTGGGAGGG - Intergenic
977993343 4:103471938-103471960 ATTCACTTGTATAAGTGAGAAGG + Intergenic
978326732 4:107566155-107566177 AGTCACATGTCAAATGAGGATGG - Intergenic
979087486 4:116430929-116430951 ATACATATATATGATGGGGATGG - Intergenic
979094357 4:116527458-116527480 AGTTACATGGATAATGGAGAAGG + Intergenic
982806757 4:159775215-159775237 ACTCACATTTTTAATGGAGAAGG - Intergenic
984247039 4:177287133-177287155 AGTCACCTGTAGAATGAGGAAGG - Intergenic
985526307 5:404270-404292 ATTCACATGTTTGATGAGAAGGG - Intronic
987154217 5:15071667-15071689 ATTGCCATTTGTAATGGGGATGG + Intergenic
987743199 5:21936715-21936737 ATCCCCATGTGTCATGGGGAGGG + Intronic
987807386 5:22786638-22786660 CTTCATTTGTGTAATGGGGAAGG + Intronic
988392105 5:30647665-30647687 AATCATATGTAAAAAGGGGAGGG + Intergenic
989002013 5:36771035-36771057 ATTCCCATGTGTTGTGGGGAGGG - Intergenic
989284102 5:39679229-39679251 ATTCACATCCATGATGGGGGAGG + Intergenic
991463682 5:66886783-66886805 ATTCACATGTATTTAGGGTAGGG + Intronic
991749717 5:69787816-69787838 ATCCCCATGTGTCATGGGGAGGG - Intergenic
991763393 5:69946824-69946846 ATCCCCATGTGTCATGGGGAGGG + Intergenic
991783934 5:70171305-70171327 ATCCCCATGTGTCATGGGGAGGG - Intergenic
991801296 5:70367630-70367652 ATCCCCATGTGTCATGGGGAGGG - Intergenic
991827303 5:70642412-70642434 ATCCCCATGTGTCATGGGGAGGG + Intergenic
991842622 5:70821884-70821906 ATCCCCATGTGTCATGGGGAGGG + Intergenic
991876379 5:71171680-71171702 ATCCCCATGTGTCATGGGGAGGG - Intergenic
992244945 5:74811152-74811174 TTTCACATTTTTAATGGAGATGG + Intronic
995856713 5:116600522-116600544 ATTGTCCTGTATAATTGGGATGG - Intergenic
996291901 5:121861053-121861075 ATACACATGTATATTGGATATGG + Intergenic
997717667 5:136054073-136054095 ATTCAAAGGTAACATGGGGAAGG + Exonic
997876760 5:137556546-137556568 ATACATATGTGTAATGAGGAAGG + Intronic
998070436 5:139193703-139193725 ATTAACTTGTATAATGGTCATGG + Intronic
998466272 5:142346831-142346853 ATTCACTTGCTTAGTGGGGAGGG - Intergenic
999804762 5:155071344-155071366 ATTCCCATGTGTTGTGGGGAGGG - Intergenic
1000492338 5:161929950-161929972 ATTCTCATATATAATTGTGATGG + Intergenic
1001529457 5:172452159-172452181 TTTCATCTGTGTAATGGGGATGG - Intronic
1004897168 6:20159716-20159738 ATACATATGTATATTGTGGAAGG - Intronic
1007165515 6:39826061-39826083 AGACACATGTCCAATGGGGAAGG - Intronic
1007283611 6:40731027-40731049 CCTCACCTGTATAATGGAGATGG - Intergenic
1007365133 6:41386211-41386233 ATTCAAATGTCTACTGGGGCTGG - Intergenic
1007699691 6:43759351-43759373 ATGCATATGTATTATGAGGAAGG - Intergenic
1012898219 6:104976282-104976304 CTTTGCATGTATAATGGTGAGGG + Intronic
1013501935 6:110760784-110760806 CCTCATCTGTATAATGGGGATGG - Intronic
1015161831 6:130160809-130160831 TTTCAAATGTAAAATGTGGAAGG + Intronic
1015355959 6:132277308-132277330 ATTCACATGTGTCAAGGGCAGGG - Intergenic
1015485008 6:133759777-133759799 AGTCACATATTTAATGAGGAGGG + Intergenic
1016524200 6:144981872-144981894 ATTCCCATGTGTCATGGGAAGGG - Intergenic
1017224963 6:152010435-152010457 ATTCCCATGGATAAGAGGGAAGG + Intronic
1017340043 6:153310516-153310538 ATTCATAGGAATAAGGGGGAGGG - Intergenic
1018552379 6:165012486-165012508 ATTTTCATGCAGAATGGGGAAGG - Intergenic
1019871794 7:3770674-3770696 AGTCTCATGTCTAGTGGGGAAGG + Intronic
1021407612 7:20291254-20291276 CTACAGTTGTATAATGGGGATGG - Intergenic
1023812671 7:43924515-43924537 AATCACTTGTTTTATGGGGAGGG + Intronic
1024297728 7:47859291-47859313 ATGCACATAGGTAATGGGGAGGG - Intronic
1026322679 7:69281322-69281344 ATTCCCATGTGTCATGGGAAGGG + Intergenic
1027598213 7:80202912-80202934 AGAAACATGAATAATGGGGATGG - Intronic
1028676377 7:93467661-93467683 ATTCACATATAGAATGAGGGGGG - Intronic
1029152311 7:98489658-98489680 ATTCATATGTATTATGGGTTAGG - Intergenic
1030076955 7:105745268-105745290 ATACACATATATATAGGGGAGGG + Intronic
1030457121 7:109790138-109790160 ATTAACATGTATAATAGTCAGGG + Intergenic
1031492605 7:122407499-122407521 TTTCATATGTGAAATGGGGAGGG - Intronic
1031869268 7:127074630-127074652 AGCAACTTGTATAATGGGGAAGG - Intronic
1033858048 7:145588988-145589010 AATCACATGTAATCTGGGGATGG - Intergenic
1034677267 7:152900855-152900877 ATTCACTTGTACACTGGGGAGGG + Intergenic
1035440510 7:158893243-158893265 ATTACCATGAATAAGGGGGAAGG - Intronic
1035441082 7:158900667-158900689 ATTCACATGTATAATGGGGATGG - Intronic
1038538165 8:28369564-28369586 AGTCACATGGGTAATGGGCAGGG - Intronic
1040487491 8:47887205-47887227 CTTCACATGGATGATTGGGAGGG - Intronic
1044389995 8:91638815-91638837 ATTTACATCTATAATGTAGAGGG + Intergenic
1045256361 8:100526979-100527001 CTTCACACGTATAATGTGGAAGG + Intronic
1046638246 8:116696977-116696999 ATTAACATGTAATATGGAGAGGG - Intronic
1047063198 8:121250846-121250868 ATCCACATATGTCATGGGGAGGG - Intergenic
1047448507 8:124941446-124941468 CTTCACCTGTAAAATGAGGATGG - Intergenic
1048127381 8:131651164-131651186 ATTCATATGAAAAATGAGGATGG + Intergenic
1051800025 9:20922274-20922296 ATCAACGTTTATAATGGGGAGGG - Intronic
1053546328 9:39026808-39026830 TCTCACATGTATAATTGGGAAGG - Intergenic
1053810643 9:41848470-41848492 TCTCACATGTATAATTGGGAAGG - Intergenic
1054619950 9:67338969-67338991 TCTCACATGTATAATTGGGAAGG + Intergenic
1054864671 9:69987852-69987874 ATTGATATGCATATTGGGGAGGG - Intergenic
1055962158 9:81830937-81830959 ATTAACGTGAATAATGTGGAAGG + Intergenic
1056222157 9:84460697-84460719 GTTCATATGTTTAATGTGGATGG + Intergenic
1056268128 9:84920183-84920205 ATTCACATTCATAAGGTGGAGGG + Intronic
1056869409 9:90263566-90263588 ATTCCCATGGGTAATGGGGCTGG - Intergenic
1059980177 9:119762825-119762847 ATTCACACGTATTTTGGGAAAGG + Intergenic
1185935323 X:4250018-4250040 TTTCATCTGTAAAATGGGGAGGG + Intergenic
1186444151 X:9611826-9611848 CCTCACATATAAAATGGGGATGG - Intronic
1187546971 X:20265290-20265312 ATTCTCCGGTATAATGGAGAGGG - Intronic
1188948592 X:36339587-36339609 ACTGACATGTATAACAGGGAAGG - Intronic
1189086053 X:38025751-38025773 ATTAAAATGTGTAATGGGTAAGG + Intronic
1195523614 X:105859790-105859812 AATCACATGTGTATTGGGGCAGG + Intronic
1198420651 X:136468315-136468337 TCTCACCTGTAAAATGGGGATGG - Intergenic
1198642668 X:138773912-138773934 ATTCACGTGTATATTTGTGAAGG - Intronic
1199043817 X:143145939-143145961 ATGTACATGTATAATGGTGAAGG - Intergenic