ID: 1035441230

View in Genome Browser
Species Human (GRCh38)
Location 7:158902736-158902758
Sequence CCTCCTATGTGGTAGCTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 1, 2: 1, 3: 11, 4: 142}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035441230 Original CRISPR CCTCCTATGTGGTAGCTGCA AGG (reversed) Intronic
900604863 1:3519405-3519427 ACTCCCAGGTGGGAGCTGCACGG + Intronic
904581819 1:31549275-31549297 CCTACTATGTGCTAGGTGCTGGG + Intergenic
905404411 1:37723349-37723371 CCTCCTTTGCCATAGCTGCAGGG + Exonic
905415466 1:37800783-37800805 CTTCCTATGTGCTAGGTGCTGGG + Exonic
905898705 1:41566459-41566481 CCTCATGTGTGTTTGCTGCAAGG - Intronic
908965589 1:69758138-69758160 CCTACTATGTGCTAGATGCCAGG + Intronic
909030797 1:70537185-70537207 ATGCCTCTGTGGTAGCTGCAAGG - Intergenic
912398572 1:109368734-109368756 CCTCCTTTGTGGCAGGGGCAGGG + Intronic
915570090 1:156740644-156740666 CCTTCTGTGTGATTGCTGCAAGG + Intronic
919119580 1:193322216-193322238 CCTCCTATCTTTTAGCTGAAGGG + Intergenic
919765665 1:201125726-201125748 CCTCCTATGTGTCAGGGGCAGGG - Intronic
920097237 1:203494163-203494185 CCACCTTTCTGGAAGCTGCAGGG + Exonic
921377808 1:214492286-214492308 TCTCCTAAGTGATAGCTACATGG - Intronic
923430623 1:233916728-233916750 GTTCCTATGTGGTGGCTGGAAGG + Intronic
923550049 1:234956689-234956711 CCTGTTATGTGTTAGGTGCAGGG - Intergenic
1062927095 10:1325374-1325396 CCTCCTATGTTTTAGCTGTTTGG + Intronic
1064227931 10:13503957-13503979 CCTCCTAGGCAGCAGCTGCAGGG - Intronic
1064461637 10:15540354-15540376 ACTCCTATGTGGGAGCTAAAAGG - Intronic
1067470756 10:46536175-46536197 CCTCCTGTGTGGCAGGGGCAGGG - Intergenic
1069622310 10:69845529-69845551 CCTACTTTGGTGTAGCTGCAGGG - Intronic
1070777886 10:79120631-79120653 CCTCCTATACGGTGGCCGCAAGG + Intronic
1071378067 10:85030945-85030967 CCTCCACTGAGGTAGTTGCAAGG + Intergenic
1074877022 10:117621639-117621661 CCTCCAATGAGGAAGCTGTAAGG - Intergenic
1081748930 11:45494025-45494047 CTCCCTATGTGTTAGCTGCCTGG - Intergenic
1083467108 11:62855738-62855760 CCTTCTGTGTTGTAGCTGCCTGG - Intergenic
1083652158 11:64210016-64210038 CCTCCCATGTGGTAGCTGCAGGG - Intronic
1085339519 11:75722122-75722144 CCTCATATGTGTTTCCTGCAGGG + Intronic
1086066418 11:82749934-82749956 CATTCTATGTGGTAGATACATGG + Intergenic
1086645991 11:89220845-89220867 ATTCCTATGTGGTAGGTGCTAGG - Intronic
1091749117 12:3011555-3011577 CCTCCTAAGTGATGGCAGCAGGG - Intronic
1096633600 12:52945082-52945104 CCACCTATGTGCCAGATGCAGGG + Intronic
1097044182 12:56174910-56174932 CCTGCTATGTGCTAGATGAAAGG + Intronic
1097821763 12:64134998-64135020 CCTCCCATGAGGCAGCTGCCAGG - Intronic
1098299459 12:69039170-69039192 CCTCTTCTGTGCTAGGTGCAAGG + Intergenic
1098941660 12:76543676-76543698 ACTCCAATGGGGTAGCTGCCTGG + Intronic
1101434583 12:104654091-104654113 CCTCCTATGTGCTAGGTGCCGGG + Intronic
1102862545 12:116349328-116349350 ACTCCTAGGTGGTGGCTGCTTGG - Intergenic
1103161210 12:118730804-118730826 CCTCCTATGTGCTAGTGGCAGGG - Intergenic
1112202897 13:97294638-97294660 TCTCCAATGCTGTAGCTGCATGG + Intronic
1113278137 13:108757833-108757855 CCTCATATGAAGTAGCTACATGG - Intronic
1119494002 14:75063358-75063380 CTGGCTATTTGGTAGCTGCATGG - Intronic
1121471317 14:94156516-94156538 ATTCCTATATGGTAGCAGCATGG - Intronic
1123154975 14:106215970-106215992 CCTATTATTTGGTAGCTGGAAGG + Intergenic
1123401635 15:19993189-19993211 CCTATTATTTGGTAGCTGGAAGG + Intergenic
1127937980 15:63661802-63661824 CCTGTTATGTGGCACCTGCAGGG - Exonic
1128416074 15:67447296-67447318 TGTCCTACATGGTAGCTGCAAGG + Intronic
1130059692 15:80560535-80560557 CCTTCTGTGTGCTAGTTGCATGG + Intronic
1132466388 16:79162-79184 CCACATATGTGCGAGCTGCACGG - Exonic
1132767782 16:1543235-1543257 CTTCCTCTGTGGGAACTGCAGGG - Intronic
1134572825 16:15306254-15306276 CCTCATATGTGGAAGGTGGAAGG - Intergenic
1134729561 16:16449782-16449804 CCTCATATGTGGAAGTTGGAAGG + Intergenic
1134937875 16:18262124-18262146 CCTCATATGTGGAAGGTGGAAGG - Intergenic
1135188171 16:20332806-20332828 TCTACTATGTGCTAGCTGCCGGG - Intergenic
1135399525 16:22156574-22156596 TCTCCTATGTGGCAGCTTCTGGG - Exonic
1138457393 16:57129222-57129244 GCCCCTATGTGGTCCCTGCAGGG - Intronic
1140882974 16:79215580-79215602 CCTCCTCTGTGGATCCTGCAGGG + Intergenic
1141019646 16:80483182-80483204 CCTGCTATGTGATAGCCCCATGG - Intergenic
1144649069 17:16996135-16996157 CTTCCTATGTGGGACCAGCAGGG - Intergenic
1145290771 17:21544034-21544056 ACTCCTATGTGAGAGCGGCATGG + Intronic
1146454190 17:32996625-32996647 CATGCTATTTGGTAGCTGGATGG + Intronic
1146801648 17:35829006-35829028 CCTCCTATGTCTTACATGCATGG - Intronic
1147122468 17:38343740-38343762 CCTCCTATGTGGGGGCTGCTGGG - Exonic
1151447666 17:74177752-74177774 CCTTCTGTGTGCTAGCTACAGGG - Intergenic
1152726451 17:81949065-81949087 ACTCCTATGTGGTCTCTGGAGGG - Intergenic
1156303542 18:35856273-35856295 CCTCCTCTGGGGCAGCTGCCAGG + Intergenic
1157551916 18:48588143-48588165 CCTCCTAAGTGGCAGCTCCATGG + Intronic
1158679962 18:59558521-59558543 CCTCCCATGTTGTGGCTACATGG - Intronic
1160424786 18:78772493-78772515 CCTCCTGTCAGGTAGCTTCAGGG + Intergenic
1160625730 18:80203627-80203649 CCTCATCTGTGGTTGCTGAAGGG + Intronic
1161388704 19:4010225-4010247 CCTCCGAGGTGGCAGCTGCTGGG + Intronic
1161609346 19:5232395-5232417 CCTCCTATGTGCCAGCAACAAGG + Intronic
1162804679 19:13131184-13131206 CCTCCTTTGTGGGAGGTGCTGGG - Intronic
1164715903 19:30390145-30390167 CTTCCTAGGGGTTAGCTGCAGGG + Intronic
1167385869 19:49163127-49163149 TGTCCAATGTGATAGCTGCATGG - Intronic
925263488 2:2547880-2547902 CCTGCTGTGGGGTGGCTGCAGGG + Intergenic
926196836 2:10769108-10769130 CCTCCCCTGTGGAGGCTGCACGG + Intronic
926382154 2:12301564-12301586 CCTACTATGTGCTAGGTGCCTGG + Intergenic
926553444 2:14328800-14328822 CCTCCAGTGAGGTAGCTGCCTGG + Intergenic
929792399 2:45033196-45033218 TCTCCTATGTGGCAACTGCAGGG - Intergenic
931372249 2:61674354-61674376 CTTCCTATGTGCTAGCTGCTGGG - Intergenic
931832805 2:66070115-66070137 CTTGCAATGTGGTAGCTGGAGGG + Intergenic
932638804 2:73420204-73420226 CCTCCTATGTGTTTGATGCTAGG + Intronic
935373821 2:102375204-102375226 CATCCCATGTGGTCCCTGCATGG + Intronic
935883264 2:107588133-107588155 CCTCCTCTGTGGTAGATGGTAGG - Intergenic
938965296 2:136382717-136382739 CCTACTATATGCTAGGTGCAAGG + Intergenic
939125028 2:138167245-138167267 CCTACTATGTGGTTGCTTTATGG - Intergenic
940423802 2:153508814-153508836 TCTCCCAAGTGGGAGCTGCATGG + Intergenic
945333931 2:208569773-208569795 CTTCCTTTGTGAGAGCTGCAGGG + Intronic
1172045396 20:32076489-32076511 CCTCCTCCATGGTTGCTGCAAGG - Intronic
1172321137 20:33995672-33995694 AGTCCTATGTGGGAGCTGAAAGG + Intronic
1172804611 20:37602840-37602862 CCTGCTCTGTGGTTACTGCAGGG + Intergenic
1175536737 20:59720034-59720056 CCTCCTATGAGAGAGCTGGAAGG - Intronic
1176613816 21:9011200-9011222 CCTCTTTTGTGCTAGCTCCAAGG - Intergenic
1177132016 21:17270332-17270354 CCTCCTGTGTGGTAAATGCTTGG + Intergenic
1181821451 22:25478949-25478971 CCTACTATGTGCCAGGTGCAGGG + Intergenic
1182379093 22:29872016-29872038 CCTTTTATGTGGAAGCCGCATGG - Intergenic
1184239387 22:43203920-43203942 CCTCCACAGTGGGAGCTGCATGG - Exonic
950222138 3:11204690-11204712 TTTACTATGGGGTAGCTGCAGGG - Intronic
953780904 3:45869628-45869650 CCTCCTTTGTGGAAGGTGCCTGG + Intronic
954202386 3:49031513-49031535 CCTCCTATCTGTAAGCTCCATGG - Intronic
956321593 3:68003461-68003483 CCTACTATGTGTTAGGTGCCTGG - Intergenic
960194731 3:114751478-114751500 CCTACTATGTGGCACCTGCTAGG + Intronic
960422543 3:117464834-117464856 CATTCTCTGTGATAGCTGCACGG + Intergenic
960569402 3:119171033-119171055 CCTTCTCTGTGGTAGTTCCAAGG - Intronic
960697246 3:120408075-120408097 CCTCCTATGCTGTAATTGCAGGG + Intronic
962382934 3:134911714-134911736 CCTCCTGGAGGGTAGCTGCATGG + Intronic
963134252 3:141886235-141886257 CACCCTATGTTGTAGCTACACGG + Intronic
964918770 3:161870306-161870328 CTTCCTACGTGGTATCTCCAGGG + Intergenic
972336465 4:38111125-38111147 CCTCCTAAATGGGAGCTGGAGGG + Intronic
979691103 4:123559397-123559419 CCCCCTAGTTGGAAGCTGCAGGG - Intergenic
980860767 4:138496772-138496794 ACTCCTATGTGGGAGCTCAAAGG - Intergenic
985581186 5:696016-696038 CCTCCTATGTGACAGCTGCCTGG - Intergenic
985595810 5:787348-787370 CCTCCTATGTGACAGCTGCCTGG - Intergenic
990876308 5:60490318-60490340 CCTGCTATGTGACAGCTCCAAGG - Intronic
992214089 5:74508476-74508498 CCTCATATGAGGGAGCTTCAGGG - Intergenic
994349459 5:98727679-98727701 CTTCCTGAGTGGTCGCTGCAGGG + Intergenic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
997255201 5:132423116-132423138 CCTCCAAAGTGGGAGCTGCAGGG + Intronic
998544644 5:143016369-143016391 CCTCCTGTGTGCTAGATGAAAGG - Intronic
1002862632 6:1093737-1093759 CCTTCTCTGTGCTAGCTGCCGGG - Intergenic
1004464268 6:15869578-15869600 CCTCAAATTTGGTATCTGCAGGG + Intergenic
1006741652 6:36313189-36313211 CCTCATTTGTGTTGGCTGCAGGG - Intergenic
1007082823 6:39120706-39120728 CTTGGTATGTGGTACCTGCAAGG - Intergenic
1016355412 6:143212790-143212812 CCTCCTATCAAGTAGCAGCATGG + Intronic
1029804138 7:102978513-102978535 ACTGCTATGTGGTACCTGGATGG - Intronic
1035183186 7:157105680-157105702 CTTCTTATGTGGCAGCAGCAAGG - Intergenic
1035441230 7:158902736-158902758 CCTCCTATGTGGTAGCTGCAAGG - Intronic
1036111386 8:5906744-5906766 CCAACTCTGTGCTAGCTGCATGG - Intergenic
1038170082 8:25123411-25123433 CCTTCTATCCTGTAGCTGCAGGG + Intergenic
1042559011 8:70058543-70058565 CCTTGTAGGTGCTAGCTGCAGGG - Intronic
1042749454 8:72141969-72141991 TTTCCTATGTTGTAGCAGCAAGG + Intergenic
1043260285 8:78186650-78186672 CCTCCTCTGAGGTAGTTGCCAGG - Intergenic
1045331267 8:101157701-101157723 CCTTCCATGTGCTAGCTACATGG - Intergenic
1049386314 8:142344744-142344766 GCACCTCTGTGGTGGCTGCAGGG - Intronic
1049917363 9:331181-331203 CCTTCTATATGGTAGCAGCTGGG - Intronic
1052104987 9:24502759-24502781 CATCTTATGTGGTAGCTCCATGG - Intergenic
1055103783 9:72492186-72492208 TCTCCTATGTGGCAGTTTCAGGG + Intergenic
1055569774 9:77604758-77604780 CCACCTATGGGGTTGTTGCAAGG + Intronic
1057745974 9:97751578-97751600 GGTCCTACTTGGTAGCTGCATGG - Intergenic
1059060941 9:111035126-111035148 CCTTCCATGTGGTAGATGCAAGG - Intronic
1061981689 9:134108409-134108431 CCTCCTATGTGGGAGCTACAAGG + Intergenic
1062198529 9:135288034-135288056 CCTCCTGTGAGGCAGCTGAAGGG - Intergenic
1185735387 X:2491909-2491931 CCTCCTGAGTGGCAGCTGGAAGG - Intronic
1186441392 X:9589867-9589889 CCACCTAGGTGGTATCTGCTGGG - Intronic
1188657246 X:32713531-32713553 CCTACTATATAGTAGCTGAAAGG - Intronic
1190182270 X:48203181-48203203 CCTCTTCTGTGGCATCTGCAGGG - Intronic
1190195401 X:48313868-48313890 CCTCTTCTGTGGCATCTGCAGGG - Intergenic
1190209098 X:48430102-48430124 CCTCTTCTGTGGCATCTGCAGGG + Intergenic
1190313478 X:49134001-49134023 CTTCCTATGTGATCTCTGCATGG - Intergenic
1190661854 X:52662091-52662113 CCTCTTCTGTGGCATCTGCAGGG - Intronic
1190676637 X:52788545-52788567 CCTCTTCTGTGGCATCTGCAGGG - Intronic
1192043030 X:67643361-67643383 TCTCACATGTGGAAGCTGCAAGG + Exonic
1192944520 X:75950443-75950465 CCTTCTACATGGGAGCTGCAGGG + Intergenic
1196160220 X:112474689-112474711 ACTCCAATGTGGCAGCTTCATGG - Intergenic
1198792875 X:140364774-140364796 CCTCCACTGTGAAAGCTGCAGGG - Intergenic
1198974397 X:142319236-142319258 CCTCTTAGGTGGAAGCAGCAAGG + Intergenic