ID: 1035447070

View in Genome Browser
Species Human (GRCh38)
Location 7:158950372-158950394
Sequence CTGGTCCTGGTGCTCACACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 247}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035447070_1035447076 14 Left 1035447070 7:158950372-158950394 CCAGGTGTGAGCACCAGGACCAG 0: 1
1: 0
2: 1
3: 22
4: 247
Right 1035447076 7:158950409-158950431 CAGGTGTTCTATATGATTCCAGG 0: 9
1: 0
2: 1
3: 10
4: 141
1035447070_1035447072 -5 Left 1035447070 7:158950372-158950394 CCAGGTGTGAGCACCAGGACCAG 0: 1
1: 0
2: 1
3: 22
4: 247
Right 1035447072 7:158950390-158950412 ACCAGCCTCTATATGATTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035447070 Original CRISPR CTGGTCCTGGTGCTCACACC TGG (reversed) Intronic
900942876 1:5812321-5812343 CTGGTCCTGGTGATCCTGCCAGG - Intergenic
901460876 1:9390889-9390911 CTGGTCTTGGTCCTCACATTTGG + Intergenic
901551831 1:10001206-10001228 CTGATCCTGCAGCTCCCACCCGG + Intronic
901687233 1:10949683-10949705 CTGGTCCTGCAGCCCACACCTGG + Exonic
902271666 1:15309397-15309419 CTGCTCATGGGGCTCACACTTGG + Intronic
902613068 1:17608384-17608406 CTGGGACTGATGCTCAGACCAGG + Intronic
903672027 1:25042085-25042107 CTGGCACTGGTGCTGGCACCTGG - Intergenic
903825815 1:26145180-26145202 CTGGTCTTGCTGCGCACACCTGG - Intergenic
903846833 1:26283890-26283912 CTGGGCCTTGGGCTCACCCCTGG + Intronic
904557794 1:31376594-31376616 CTCGCCATGGTGCTCAGACCTGG + Intronic
904747640 1:32720784-32720806 CTGGTCCTGGAGCCTACCCCTGG + Intergenic
905371484 1:37484855-37484877 CTGGTTCTGGTCCCCAAACCAGG + Intergenic
905394745 1:37659975-37659997 CTTGACCAGGTGCTCACGCCTGG - Intergenic
906747514 1:48232130-48232152 CTGGTGTTGGTGCACAGACCAGG + Exonic
908358568 1:63345847-63345869 CCAGGCTTGGTGCTCACACCTGG - Intergenic
909596003 1:77406740-77406762 CAGTACCTGGTGCTCACACCAGG + Intronic
909631785 1:77775722-77775744 CTGGCACTGTGGCTCACACCTGG - Intergenic
910025515 1:82646503-82646525 CAGGTCCTAGTGCTAACAGCAGG - Intergenic
913379386 1:118192028-118192050 GTGGGCCTGGTGCTCACAGCAGG + Intergenic
915439679 1:155937632-155937654 CTGGGCACGGGGCTCACACCTGG - Intergenic
915450772 1:156003490-156003512 CTGTTCCTGGTGCTGACGCTAGG - Intronic
916171777 1:162006624-162006646 CTGGTACCGGTGCTCAGCCCAGG - Intronic
918117450 1:181509172-181509194 CTGGTCTTGGTGCTGGCATCAGG - Intronic
921155079 1:212432995-212433017 CTGGTCCTGGCGCTGGCCCCGGG + Exonic
921188075 1:212686662-212686684 CTGGTCCTGGAGCTCCCAGGAGG + Exonic
921600911 1:217105495-217105517 ATGGTCCGAGTGCTCAAACCTGG + Intronic
921722799 1:218492102-218492124 CTGGTCTTGGTCTTCACACTTGG + Intergenic
922700391 1:227756121-227756143 CTGGTCATGGTCCTCACATTTGG + Intronic
922720849 1:227899516-227899538 CAGGTGCAGGTGCTCACGCCAGG + Intergenic
923918042 1:238530545-238530567 CTGCTCCTGGTGCCCACTCTGGG - Intergenic
1063355517 10:5395187-5395209 CTGGTCTGGGTGCTCAGAACTGG - Intronic
1065593711 10:27291797-27291819 CTGATCCTGGTGCTAAGAGCAGG + Intergenic
1067015341 10:42753822-42753844 CGGGTTCTGGAGCTCACGCCTGG - Intergenic
1068118491 10:52760554-52760576 CTGCTCCTTGTGCTCTCACATGG - Intergenic
1069828476 10:71268558-71268580 CTGGTGGTGGTGCTGACAGCAGG + Intronic
1070144093 10:73761070-73761092 CTGGTGCTGCTGCTCACTCTTGG - Intronic
1071555395 10:86597585-86597607 CAGGTCCGGGTGCACACAGCAGG - Intergenic
1073066064 10:100759852-100759874 CTGGTCTTGGTGCTCCCTCTTGG + Intronic
1073766898 10:106692341-106692363 CTGGCGCTGTGGCTCACACCTGG - Intronic
1076018654 10:127051857-127051879 CAGGTGCTCTTGCTCACACCTGG - Intronic
1076809546 10:132879487-132879509 CTGGCCCTGGTGCTGTCGCCGGG - Exonic
1077112269 11:867013-867035 CTGGTCCTGGTGCTCCAGGCGGG + Exonic
1077195031 11:1275282-1275304 CCGGTGCTGGTGGCCACACCTGG + Exonic
1077373223 11:2193335-2193357 CTGGGGCTGGTGCACCCACCAGG - Intergenic
1077701423 11:4445489-4445511 GTGCTCCTGCTGCCCACACCTGG - Intergenic
1078604453 11:12762877-12762899 CAGGTGCTGGTGGCCACACCTGG - Intronic
1079120704 11:17682681-17682703 CTGGCCCTCTGGCTCACACCTGG + Intergenic
1080163581 11:29209947-29209969 CTGGTCATGGTCCTCACATTTGG - Intergenic
1080610250 11:33897933-33897955 CTGGGCCAGGTACGCACACCTGG - Intergenic
1081755870 11:45544019-45544041 CTGTCCCTGGTGCTGACCCCAGG - Intergenic
1084577254 11:69997418-69997440 ATGGTCCTGGGGCTCACTCCTGG - Intergenic
1085055741 11:73402555-73402577 CTGGTTCTGGTCCTCACCCATGG + Intronic
1085467478 11:76734139-76734161 CTGGGCCTGGTTCTGACTCCAGG - Intergenic
1085905194 11:80751744-80751766 CTGGTCCTGGTCTGCACTCCTGG + Intergenic
1087098624 11:94344307-94344329 CTGGTCCAGGTGCTCATAGGAGG + Intergenic
1089116995 11:116103395-116103417 CTTGTCCCGGTGCTCACATAGGG + Intergenic
1089383561 11:118053027-118053049 CGGGTCCGGTGGCTCACACCCGG + Intergenic
1089603280 11:119627720-119627742 CACATCCTGGTTCTCACACCAGG + Intronic
1090868539 11:130723170-130723192 CCTGTCCTGGTGCTGACATCTGG + Intergenic
1091589441 12:1834675-1834697 CTGGTCCTCGTGCTCGCCCTCGG - Exonic
1091881494 12:3982154-3982176 ATGCTCCTGATGCTCACACAGGG + Intergenic
1092743869 12:11654983-11655005 CTGCCTCTGGTGCTCACATCTGG - Intronic
1095472741 12:42553737-42553759 CTGGTTCTGCTGCTTACACCAGG + Intronic
1096107139 12:49002915-49002937 CAGGCCCTGGTGCTCACAGGTGG - Exonic
1096785371 12:54014333-54014355 CTGGTGCCGCTGCTCACAGCAGG - Intronic
1097429422 12:59486141-59486163 CTGGGCCTTCTGCTCACACATGG + Intergenic
1098707849 12:73713766-73713788 CTGGTCCAGGTAAGCACACCTGG + Intergenic
1101580967 12:106040491-106040513 CTGCTCCTGGTGCCCACCCTGGG - Intergenic
1101693708 12:107104889-107104911 CTGGTGCTGGTGATGCCACCTGG + Intergenic
1101847111 12:108371410-108371432 CTGGTAGTGGTGGTCACAGCTGG - Intergenic
1104368742 12:128203084-128203106 CTGAGCCATGTGCTCACACCTGG - Intergenic
1106430597 13:29676810-29676832 CTTGTCCTGGTGATCATACAAGG - Intergenic
1108245704 13:48510963-48510985 CTGGGGCAGGTGCTCACGCCAGG - Intronic
1110596723 13:77327330-77327352 CTGGTCCTCGTTCTTCCACCTGG - Intergenic
1112328775 13:98461587-98461609 ATGATCCAGGTGTTCACACCAGG - Intronic
1113441729 13:110334328-110334350 ATGGTGGTGGTGCTCACAACAGG - Intronic
1114980596 14:28158516-28158538 CTGCTCCTGGTGCCCACTCTGGG - Intergenic
1116324485 14:43514849-43514871 CAGGTGCTGGTGTTCACAGCTGG + Intergenic
1116961574 14:50973138-50973160 CTGCTCCTGGTGCCCCCTCCAGG + Intergenic
1117412758 14:55465869-55465891 CTGGCCCTGGAGCTCCCACCAGG + Intergenic
1117988532 14:61411863-61411885 CTGTTTCTGGTGCTCACACGGGG + Intronic
1118864009 14:69688457-69688479 CAGGTCCTGGTTCTAACAGCTGG - Intronic
1121149175 14:91615105-91615127 CTGGTACTGGTCCTCAGCCCGGG - Intronic
1121732191 14:96194564-96194586 GGGGTCCTGGGGCTCACACCCGG + Intergenic
1122133179 14:99618052-99618074 CTGGTCCAGGGGCTCCCAGCAGG + Intergenic
1202937798 14_KI270725v1_random:108297-108319 CTGGTCGTGGGGTGCACACCTGG - Intergenic
1123439629 15:20281156-20281178 CTGGACCCGGTGCCCAGACCTGG - Intergenic
1123963671 15:25434745-25434767 CTGGTTCTGGTTCTGACACCTGG + Intronic
1124012983 15:25853542-25853564 CTGGCACTGGTACTCACAACCGG - Intronic
1124027838 15:25983225-25983247 CAGGTCATGGTCCTCACACTTGG - Intergenic
1125447187 15:39770906-39770928 CTGCTCCTTGAGCTCACACTGGG + Intronic
1126100457 15:45115489-45115511 CTGGTCCTGGTTCTGCCTCCTGG - Intronic
1128855837 15:71013893-71013915 ATGATCCTGGTGCTCACAGCTGG - Intronic
1130256545 15:82328503-82328525 CTGGGCCTGGTGGCCACACAGGG - Intergenic
1130598407 15:85261485-85261507 CTGGGCCTGGTGGCCACACAGGG + Intergenic
1131266792 15:90920238-90920260 CTGATCCTGCTCATCACACCAGG - Exonic
1132237605 15:100233864-100233886 CTCTTCCTGGTGCTCACTCCCGG - Intronic
1132648974 16:1012007-1012029 CGGGTGCTCCTGCTCACACCAGG - Intergenic
1133390358 16:5405181-5405203 ATGGTCCTGGCCCTCCCACCTGG - Intergenic
1134078475 16:11308734-11308756 CTGCCCCGGGTGTTCACACCTGG + Intronic
1136138366 16:28272344-28272366 CTGTACCAGGGGCTCACACCTGG - Intergenic
1137780795 16:51096152-51096174 CCGTTCCTGGGGTTCACACCTGG + Intergenic
1137858971 16:51827042-51827064 CAGGTGCTGTGGCTCACACCTGG - Intergenic
1141097384 16:81172536-81172558 CGTGGCCTGTTGCTCACACCTGG + Intergenic
1141345038 16:83237022-83237044 TTCCTCCTGGTCCTCACACCTGG - Intronic
1142334084 16:89475771-89475793 CAGGTGCGGGGGCTCACACCTGG + Intronic
1142619799 17:1157739-1157761 ATGGTCCTGCTGATCCCACCAGG - Intronic
1143111182 17:4553912-4553934 CTGGTCCTGGTCCCCACAGAGGG + Exonic
1143190484 17:5036370-5036392 CTGGACGTGGTGTGCACACCTGG + Intronic
1143536209 17:7541527-7541549 TTGGGCCTGTAGCTCACACCTGG - Intergenic
1144825412 17:18103027-18103049 ATGGTCCTTGTGCTCAGGCCGGG - Intronic
1144946282 17:18971197-18971219 CTGGTACTGGTGCACCGACCAGG + Exonic
1146499355 17:33351309-33351331 CTGCTCATGGTGCTTAGACCTGG - Intronic
1146685958 17:34841800-34841822 ATGGCCCTTGTGCTCACAGCAGG - Intergenic
1148436823 17:47692127-47692149 CTAGTTCTGCTGCTCATACCAGG - Intergenic
1148737147 17:49871263-49871285 CTCCTTCTGGTCCTCACACCTGG + Intergenic
1149991344 17:61385238-61385260 CTGGTGCTGGCGCTGGCACCTGG - Intronic
1151862589 17:76776253-76776275 CTGGTGCGGTGGCTCACACCTGG - Intronic
1152223463 17:79081858-79081880 CTGGGCCTGGGCCTCACAGCAGG + Intronic
1152225200 17:79089761-79089783 CTGCTCCTGCTCCTCCCACCGGG + Intronic
1152706304 17:81845325-81845347 CCGGTCCGGTGGCTCACACCCGG + Intronic
1153338254 18:3947322-3947344 CTGATCATGGTGCTGACACTAGG + Intronic
1157515621 18:48309033-48309055 CTGGCCATGGTCCTCACCCCTGG + Intronic
1159028478 18:63208026-63208048 CTGCTCCTGGTCCTACCACCTGG + Intronic
1159450220 18:68591602-68591624 CAGTACCTGGTGCTCACACAGGG - Intergenic
1160265983 18:77341118-77341140 GTGGTCCTCTTGATCACACCAGG - Intergenic
1160565299 18:79783249-79783271 CTGGCCCTGCTGCTCCCGCCCGG + Intergenic
1161033060 19:2068384-2068406 CTGGTGCGGTGGCTCACACCTGG - Intergenic
1161269780 19:3383438-3383460 CTGGTCCCGGTGCTAAGAGCAGG + Intronic
1161378777 19:3953602-3953624 CTTGTCCTGGAGGTCACGCCTGG + Intergenic
1161615704 19:5269052-5269074 TTGGTCTTGGTGCCCACAGCTGG + Intronic
1162818672 19:13210260-13210282 CTGGTCCTGCAGCTCCTACCTGG - Intronic
1163365512 19:16873789-16873811 CTGGGCCAGGTGCTCACTGCGGG + Intronic
1163460722 19:17435967-17435989 CTGGCTCTGGTGCTCAGTCCTGG + Exonic
1163552622 19:17974064-17974086 CTGGTCCTGGGGCTGCCCCCGGG - Exonic
1164404793 19:27935247-27935269 TTGGTCCTGGTGCCCAGCCCTGG + Intergenic
1167213042 19:48145539-48145561 CTGATTCTGATGCTCACACAGGG + Intronic
1168280563 19:55303367-55303389 CAGGTCCTGGTCCTCACAGCTGG - Exonic
928934399 2:36659979-36660001 CAAGTTCTGGTGCCCACACCAGG + Intergenic
929864821 2:45709096-45709118 CTGGCGCTGCTGCTCACACCTGG + Intronic
932564523 2:72897129-72897151 ATGCTCATGGTGCTCACAGCAGG + Intergenic
934070525 2:88379968-88379990 CGGGTGCTGTGGCTCACACCTGG + Intergenic
935083905 2:99826348-99826370 CCGGTCATCGTGCTCACCCCTGG + Intronic
935697303 2:105781311-105781333 CAGGTCCTGTTGCTGACACAGGG + Intronic
937982588 2:127624139-127624161 CTGGGCCATCTGCTCACACCGGG - Exonic
938104342 2:128519993-128520015 CTGGTCCAGGTGCTGAGATCTGG - Intergenic
938986071 2:136577735-136577757 GTGCTCTTGGTGCTAACACCTGG - Intergenic
942890003 2:180978281-180978303 CTGGCCCTAGTGCTCTCTCCAGG + Intronic
944370173 2:198973621-198973643 CTGTTCCTTGTGCCCACACATGG + Intergenic
948732407 2:239975401-239975423 CTGTGCATGGTGCTCACCCCAGG + Intronic
948799416 2:240424893-240424915 CTGGTGCTGGTGAGGACACCAGG + Intergenic
948827242 2:240578603-240578625 GTGGTGCTGGTGCTCTCTCCAGG + Exonic
949022582 2:241749824-241749846 CTGATGCTGGTGGTGACACCAGG + Intronic
949022592 2:241749867-241749889 CTGATGCTGGTGGTGACACCAGG + Intronic
949022606 2:241749952-241749974 CTGATGCTGGTGGTAACACCAGG + Intronic
949072344 2:242033239-242033261 CAGTGCCTGGTGCTCACTCCTGG - Intergenic
1172614380 20:36273966-36273988 CTGGTGCTGGGACTCACAGCGGG + Intergenic
1172972933 20:38886634-38886656 ATGGTCCTGAGGCTAACACCAGG + Intronic
1174331304 20:49820819-49820841 CTGGTGCGGTGGCTCACACCTGG - Intronic
1175467308 20:59198090-59198112 GTGTGCCTGGTGCCCACACCTGG + Intronic
1176169752 20:63691433-63691455 CTGCACCTGGAGCTCACTCCAGG - Intronic
1177404433 21:20646572-20646594 CTGGCACTTGTGCTCATACCTGG + Intergenic
1179979511 21:44888906-44888928 CTGGCACCGATGCTCACACCTGG - Intronic
1181516221 22:23415166-23415188 CTGGTCCTGGTTAGCACAGCAGG + Intergenic
1181966984 22:26663622-26663644 GAGGCCCTGGTGCTCACAACTGG + Intergenic
1182342102 22:29631509-29631531 CTGGTCATTGTGCTCAAAACAGG - Intronic
1182713181 22:32335197-32335219 CTGGTGCTGGTGGTCTCACTGGG - Intergenic
1184644895 22:45890286-45890308 CTGGGACTGGTGGTCCCACCCGG - Intergenic
1185370869 22:50460306-50460328 CTGGCCCCGGTGCTCCCAGCTGG + Exonic
952881118 3:37986874-37986896 CAGGTCCTGGAGCCCACTCCTGG - Intergenic
953746333 3:45576823-45576845 CTGGGCATGTTGCTCACTCCCGG + Intronic
954121136 3:48500844-48500866 CTGGTCCTGTGACTCACCCCGGG - Intronic
954436178 3:50497543-50497565 CTGGTCCCGCTCCTCTCACCTGG - Intronic
955400813 3:58590266-58590288 CTGACCCTGTTGCTCAGACCAGG + Intronic
955794861 3:62624903-62624925 CTGGGTCAGGTGCTCATACCTGG - Intronic
957671815 3:83314869-83314891 CTAGTCCTAGTGCTATCACCTGG + Intergenic
960672615 3:120167575-120167597 CTGTTCCTGGGGCACACAGCAGG - Exonic
964272027 3:154966897-154966919 CAGGTGCTGTGGCTCACACCTGG - Intergenic
965675531 3:171191512-171191534 CGGGTGCTGTGGCTCACACCTGG - Intronic
965855352 3:173081438-173081460 CTGGAGCTGGTGCTTAGACCAGG - Intronic
967215093 3:187203051-187203073 CTGGTTCTGGTTCTCACAAGTGG + Intergenic
967230293 3:187331627-187331649 CTGTTCCTGGTGGTCAGAACTGG + Intergenic
969714598 4:8862096-8862118 CTGGTCGTGGTGCCCCCTCCGGG - Intronic
985508395 5:298352-298374 CAGTGCCTGGTGCTCACTCCTGG - Intronic
985732565 5:1557479-1557501 CTGGCCCTGGTGCACGCACGTGG - Intergenic
985739651 5:1607316-1607338 CAGTGCCTGGTGCTCACTCCTGG + Intergenic
986259787 5:6134406-6134428 ATGGTCGCGGAGCTCACACCCGG + Intergenic
987966407 5:24881806-24881828 CTGGGCCAGTGGCTCACACCTGG - Intergenic
991762800 5:69938095-69938117 CTGGCCCTGGTTATCACATCTGG - Intergenic
991784528 5:70180032-70180054 CTGGCCCTGGTTATCACATCTGG + Intergenic
991842027 5:70813135-70813157 CTGGCCCTGGTTATCACATCTGG - Intergenic
991876974 5:71180420-71180442 CTGGCCCTGGTTATCACATCTGG + Intergenic
992130124 5:73683640-73683662 CAGATCCAGGTGCACACACCTGG + Intronic
992757518 5:79922329-79922351 CTCGTCCTGCTGCTCTCACAAGG + Intergenic
993992445 5:94676366-94676388 CTAGTCCTGCCGATCACACCAGG + Intronic
997043353 5:130283337-130283359 CTTGGCCTGGTGCACACTCCAGG + Intergenic
999505876 5:152195432-152195454 CTGTTCCAGGTGCTGACATCAGG + Intergenic
1002381577 5:178833150-178833172 CTGGTCCTGGTCCTCTAAGCTGG - Intergenic
1003547871 6:7075952-7075974 CTGGTTCTGGTGTCCTCACCTGG + Intergenic
1006963175 6:37954929-37954951 CTATACCTGGTGCTCACACAAGG - Intronic
1010196835 6:73248114-73248136 CAGGTCCTGGTCCTCCCTCCAGG + Intronic
1010946875 6:81985122-81985144 CAGGTCCTGCTGCTATCACCTGG - Intergenic
1011893851 6:92199851-92199873 CTGGTGCAGTGGCTCACACCTGG - Intergenic
1013485050 6:110588926-110588948 CTGGTCCTGGTGCACTCAGTTGG - Intergenic
1017604246 6:156116597-156116619 CTGGTCCTCGTCTGCACACCAGG + Intergenic
1017970003 6:159303997-159304019 CTGCTCCTGGTGCTCACCCAGGG - Intergenic
1017986591 6:159448086-159448108 ATGGCCCTGGTGCTCTCACTTGG + Intergenic
1018526166 6:164711975-164711997 CTGCTACTGGAGCTGACACCAGG + Intergenic
1018709250 6:166485995-166486017 CTGGTCCTGGTGCACACCCACGG - Intronic
1019139187 6:169932850-169932872 CTGGTCCTGCTGCACACGGCTGG + Intergenic
1020016563 7:4835058-4835080 CTGGTCCTGGAGCCCATCCCCGG - Exonic
1022493434 7:30838069-30838091 CTGGTCTTGGGGCTCACTCAAGG + Intronic
1022785916 7:33636399-33636421 CTGATTCTGGTGCTCCCACGTGG + Intergenic
1022820454 7:33954805-33954827 CTGATCCATGTGATCACACCGGG - Intronic
1024089210 7:45921463-45921485 CTGCTCCTCGTGCGCACGCCCGG + Intronic
1024206739 7:47169238-47169260 CTGGTCATTGTGCTTAGACCTGG - Intergenic
1024397589 7:48887330-48887352 CTGGTCCAGGTGTTCTCCCCTGG + Intergenic
1026052612 7:66959898-66959920 CTGGCCATGGTGCTCACACCTGG + Intergenic
1027411599 7:77925677-77925699 CTGGTCTTGATGCACCCACCTGG + Intronic
1028214304 7:88112996-88113018 CTGGGCATGGGGCTCACATCTGG - Intronic
1029136187 7:98373846-98373868 CTCGTCCTGATGATGACACCAGG - Intronic
1029336186 7:99901729-99901751 CGGTTCCTGGTGCTCACACAGGG - Intronic
1031290084 7:119923357-119923379 CTGGTGCAGTGGCTCACACCTGG - Intergenic
1032057255 7:128693637-128693659 CTGGGCCTGGTGCCCACACATGG + Intergenic
1032083485 7:128871353-128871375 CTGGGCCTGATGGGCACACCAGG - Intronic
1032418667 7:131759688-131759710 CTGGTCCAAGTGCACACACCTGG + Intergenic
1033016116 7:137673280-137673302 CGTGGCCTGGTTCTCACACCTGG - Intronic
1035447070 7:158950372-158950394 CTGGTCCTGGTGCTCACACCTGG - Intronic
1037365383 8:18116424-18116446 CTGGTCCTGGTGATCAGTGCAGG - Intergenic
1038633129 8:29263965-29263987 CAGGTGCAGGGGCTCACACCTGG + Intergenic
1039086555 8:33786018-33786040 CTGATCCTGCTGTTCACATCTGG + Intergenic
1039484212 8:37898917-37898939 CCGGTGCTGGTGTTCTCACCTGG - Intronic
1041201624 8:55455205-55455227 CTGGCCCTGGACCGCACACCCGG + Intronic
1044250827 8:90002011-90002033 CGGGCCCCGGTGCTCACTCCCGG - Intronic
1049273954 8:141710516-141710538 ATGGTCCTCCTGCTCACCCCTGG + Intergenic
1049383544 8:142329646-142329668 GTGGACCTGCTGGTCACACCTGG - Intronic
1049568809 8:143358697-143358719 ACGGTCCTGCTGCTCACCCCAGG - Intronic
1049638896 8:143705506-143705528 CTGGCCCTGGTGCTCCTCCCAGG - Intronic
1049767155 8:144360191-144360213 CTGCTCCTGGGGCTCCCACCTGG - Exonic
1051634036 9:19165573-19165595 CTGGGCACGGTGCCCACACCTGG - Intergenic
1054758141 9:68979751-68979773 CTGCTTCTGGTGCTCACTGCGGG + Intronic
1056022633 9:82456409-82456431 GTGGGCCTGGTGCTCATCCCAGG + Intergenic
1056311649 9:85347236-85347258 GTGGTCCTGCTGCACTCACCTGG + Intergenic
1056950546 9:91037489-91037511 GTGGTCCTGGGCCACACACCGGG + Intergenic
1057126465 9:92619728-92619750 CTGGCCCAGGTGCTCTCACAGGG - Exonic
1057823328 9:98352188-98352210 CTGGTCCTGGGGCTGGCCCCTGG + Intronic
1060594507 9:124840217-124840239 CGGGTCCATGGGCTCACACCTGG - Intergenic
1061146966 9:128805728-128805750 CCAGCCCTGGTGCTCACACCTGG + Intronic
1061505796 9:131031251-131031273 CTGCTGCTGCTGCTCACAGCAGG + Intronic
1061677784 9:132228115-132228137 CTGGATCTGATGCTCAGACCAGG + Intronic
1061866732 9:133495118-133495140 CGGCTCCTGGGGCTCCCACCAGG - Intergenic
1062423110 9:136493569-136493591 CTGGTCCTGGTGCCCAGCGCTGG + Intergenic
1062598936 9:137311521-137311543 CTGGGCCAGGTGCGCACGCCTGG + Intronic
1062676090 9:137744864-137744886 CTGGCCCAGGTGCCCATACCTGG - Intronic
1062716869 9:138015101-138015123 CTGGCACTGGAGCTGACACCTGG - Intronic
1203769079 EBV:40084-40106 CTGGTCCTGGAGCTCATCCGGGG + Intergenic
1203615432 Un_KI270749v1:58353-58375 CTGGTCGTGGTATGCACACCTGG + Intergenic
1186727468 X:12372616-12372638 CTGGTAATGGTGCTGAGACCAGG + Intronic
1188956142 X:36436715-36436737 CTGGTGCTGGTACTCACTGCTGG + Intergenic
1189134256 X:38532741-38532763 CTGTGCCTGGTGCTCCCCCCTGG + Intronic
1190451681 X:50588249-50588271 CTTGACCTGGTGCACACAGCAGG + Intergenic
1190765480 X:53472694-53472716 CTGGGCCTGGTCCTCACCCCAGG + Intergenic
1192053157 X:67745586-67745608 CTAGTCCTGGTTCTATCACCAGG + Intergenic
1192195910 X:69028063-69028085 CCAGTCCAGGTGCTCACCCCAGG - Intergenic
1192203683 X:69082621-69082643 CAGGTCCTGCTCCTCAGACCCGG + Intergenic
1192615407 X:72616086-72616108 CAGGTGCTGTGGCTCACACCTGG + Intronic
1194071246 X:89328754-89328776 CTGTCCTTGGTGCTCACATCAGG - Intergenic
1197468118 X:126832146-126832168 CTGGTCATGGTCCTCACATTTGG - Intergenic
1199682564 X:150237080-150237102 GTGGTGCTGGTGGTCTCACCGGG - Intergenic
1200725477 Y:6664492-6664514 CTGTCCTTGGTGCTCACATCAGG - Intergenic
1201590160 Y:15605731-15605753 CTGCTCCTGGTGGTGACACAGGG - Intergenic