ID: 1035451345

View in Genome Browser
Species Human (GRCh38)
Location 7:158979129-158979151
Sequence CTACAGCTGCAGATGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035451336_1035451345 30 Left 1035451336 7:158979076-158979098 CCACGGCGGGATGGACACTTGGA No data
Right 1035451345 7:158979129-158979151 CTACAGCTGCAGATGGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035451345 Original CRISPR CTACAGCTGCAGATGGAGCT GGG Intergenic
No off target data available for this crispr