ID: 1035454873

View in Genome Browser
Species Human (GRCh38)
Location 7:159001585-159001607
Sequence AGGCAGGCCGGCTCTCAGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035454873_1035454879 -2 Left 1035454873 7:159001585-159001607 CCGTGCTGAGAGCCGGCCTGCCT No data
Right 1035454879 7:159001606-159001628 CTGGCAGTGGCTGAAGATGCTGG No data
1035454873_1035454880 27 Left 1035454873 7:159001585-159001607 CCGTGCTGAGAGCCGGCCTGCCT No data
Right 1035454880 7:159001635-159001657 CTGCTCTGAACTTTGCTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035454873 Original CRISPR AGGCAGGCCGGCTCTCAGCA CGG (reversed) Intergenic
No off target data available for this crispr