ID: 1035454879

View in Genome Browser
Species Human (GRCh38)
Location 7:159001606-159001628
Sequence CTGGCAGTGGCTGAAGATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035454872_1035454879 -1 Left 1035454872 7:159001584-159001606 CCCGTGCTGAGAGCCGGCCTGCC No data
Right 1035454879 7:159001606-159001628 CTGGCAGTGGCTGAAGATGCTGG No data
1035454871_1035454879 2 Left 1035454871 7:159001581-159001603 CCACCCGTGCTGAGAGCCGGCCT No data
Right 1035454879 7:159001606-159001628 CTGGCAGTGGCTGAAGATGCTGG No data
1035454873_1035454879 -2 Left 1035454873 7:159001585-159001607 CCGTGCTGAGAGCCGGCCTGCCT No data
Right 1035454879 7:159001606-159001628 CTGGCAGTGGCTGAAGATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035454879 Original CRISPR CTGGCAGTGGCTGAAGATGC TGG Intergenic
No off target data available for this crispr