ID: 1035454880

View in Genome Browser
Species Human (GRCh38)
Location 7:159001635-159001657
Sequence CTGCTCTGAACTTTGCTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035454878_1035454880 7 Left 1035454878 7:159001605-159001627 CCTGGCAGTGGCTGAAGATGCTG No data
Right 1035454880 7:159001635-159001657 CTGCTCTGAACTTTGCTGACTGG No data
1035454873_1035454880 27 Left 1035454873 7:159001585-159001607 CCGTGCTGAGAGCCGGCCTGCCT No data
Right 1035454880 7:159001635-159001657 CTGCTCTGAACTTTGCTGACTGG No data
1035454872_1035454880 28 Left 1035454872 7:159001584-159001606 CCCGTGCTGAGAGCCGGCCTGCC No data
Right 1035454880 7:159001635-159001657 CTGCTCTGAACTTTGCTGACTGG No data
1035454877_1035454880 11 Left 1035454877 7:159001601-159001623 CCTGCCTGGCAGTGGCTGAAGAT No data
Right 1035454880 7:159001635-159001657 CTGCTCTGAACTTTGCTGACTGG No data
1035454876_1035454880 15 Left 1035454876 7:159001597-159001619 CCGGCCTGCCTGGCAGTGGCTGA No data
Right 1035454880 7:159001635-159001657 CTGCTCTGAACTTTGCTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035454880 Original CRISPR CTGCTCTGAACTTTGCTGAC TGG Intergenic
No off target data available for this crispr