ID: 1035456453

View in Genome Browser
Species Human (GRCh38)
Location 7:159012411-159012433
Sequence TGCCCCAAGAATCACATTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035456453_1035456455 17 Left 1035456453 7:159012411-159012433 CCATTAATGTGATTCTTGGGGCA No data
Right 1035456455 7:159012451-159012473 CGAAAAGATTTCTGATTAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035456453 Original CRISPR TGCCCCAAGAATCACATTAA TGG (reversed) Intergenic
No off target data available for this crispr