ID: 1035456792

View in Genome Browser
Species Human (GRCh38)
Location 7:159014063-159014085
Sequence TGGGACTCCTTGGGAGACCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035456780_1035456792 27 Left 1035456780 7:159014013-159014035 CCTGCTCAGCACGGCCAGCTGCC No data
Right 1035456792 7:159014063-159014085 TGGGACTCCTTGGGAGACCGAGG No data
1035456787_1035456792 -4 Left 1035456787 7:159014044-159014066 CCCTGCTCAGATGAATGCATGGG No data
Right 1035456792 7:159014063-159014085 TGGGACTCCTTGGGAGACCGAGG No data
1035456789_1035456792 -5 Left 1035456789 7:159014045-159014067 CCTGCTCAGATGAATGCATGGGA No data
Right 1035456792 7:159014063-159014085 TGGGACTCCTTGGGAGACCGAGG No data
1035456784_1035456792 2 Left 1035456784 7:159014038-159014060 CCCATGCCCTGCTCAGATGAATG No data
Right 1035456792 7:159014063-159014085 TGGGACTCCTTGGGAGACCGAGG No data
1035456783_1035456792 3 Left 1035456783 7:159014037-159014059 CCCCATGCCCTGCTCAGATGAAT No data
Right 1035456792 7:159014063-159014085 TGGGACTCCTTGGGAGACCGAGG No data
1035456782_1035456792 6 Left 1035456782 7:159014034-159014056 CCTCCCCATGCCCTGCTCAGATG No data
Right 1035456792 7:159014063-159014085 TGGGACTCCTTGGGAGACCGAGG No data
1035456785_1035456792 1 Left 1035456785 7:159014039-159014061 CCATGCCCTGCTCAGATGAATGC No data
Right 1035456792 7:159014063-159014085 TGGGACTCCTTGGGAGACCGAGG No data
1035456779_1035456792 30 Left 1035456779 7:159014010-159014032 CCTCCTGCTCAGCACGGCCAGCT No data
Right 1035456792 7:159014063-159014085 TGGGACTCCTTGGGAGACCGAGG No data
1035456781_1035456792 13 Left 1035456781 7:159014027-159014049 CCAGCTGCCTCCCCATGCCCTGC No data
Right 1035456792 7:159014063-159014085 TGGGACTCCTTGGGAGACCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035456792 Original CRISPR TGGGACTCCTTGGGAGACCG AGG Intergenic
No off target data available for this crispr