ID: 1035458466

View in Genome Browser
Species Human (GRCh38)
Location 7:159024414-159024436
Sequence CAGCTCGGGGTGCCTGGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035458466_1035458473 -7 Left 1035458466 7:159024414-159024436 CCGCCGCCAGGCACCCCGAGCTG No data
Right 1035458473 7:159024430-159024452 CGAGCTGCACCACTGTGAGGAGG No data
1035458466_1035458470 -10 Left 1035458466 7:159024414-159024436 CCGCCGCCAGGCACCCCGAGCTG No data
Right 1035458470 7:159024427-159024449 CCCCGAGCTGCACCACTGTGAGG No data
1035458466_1035458474 -1 Left 1035458466 7:159024414-159024436 CCGCCGCCAGGCACCCCGAGCTG No data
Right 1035458474 7:159024436-159024458 GCACCACTGTGAGGAGGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035458466 Original CRISPR CAGCTCGGGGTGCCTGGCGG CGG (reversed) Intergenic
No off target data available for this crispr