ID: 1035458473

View in Genome Browser
Species Human (GRCh38)
Location 7:159024430-159024452
Sequence CGAGCTGCACCACTGTGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035458463_1035458473 13 Left 1035458463 7:159024394-159024416 CCTGAAGGTGGCTGTCCTCGCCG No data
Right 1035458473 7:159024430-159024452 CGAGCTGCACCACTGTGAGGAGG No data
1035458465_1035458473 -2 Left 1035458465 7:159024409-159024431 CCTCGCCGCCGCCAGGCACCCCG No data
Right 1035458473 7:159024430-159024452 CGAGCTGCACCACTGTGAGGAGG No data
1035458462_1035458473 14 Left 1035458462 7:159024393-159024415 CCCTGAAGGTGGCTGTCCTCGCC No data
Right 1035458473 7:159024430-159024452 CGAGCTGCACCACTGTGAGGAGG No data
1035458467_1035458473 -10 Left 1035458467 7:159024417-159024439 CCGCCAGGCACCCCGAGCTGCAC No data
Right 1035458473 7:159024430-159024452 CGAGCTGCACCACTGTGAGGAGG No data
1035458466_1035458473 -7 Left 1035458466 7:159024414-159024436 CCGCCGCCAGGCACCCCGAGCTG No data
Right 1035458473 7:159024430-159024452 CGAGCTGCACCACTGTGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035458473 Original CRISPR CGAGCTGCACCACTGTGAGG AGG Intergenic
No off target data available for this crispr