ID: 1035459361

View in Genome Browser
Species Human (GRCh38)
Location 7:159029762-159029784
Sequence TCCTCAGCCCGCCTTCCGTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 97}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035459351_1035459361 30 Left 1035459351 7:159029709-159029731 CCTGTGTGGAGAGGTCCCCTCCT 0: 1
1: 0
2: 0
3: 18
4: 159
Right 1035459361 7:159029762-159029784 TCCTCAGCCCGCCTTCCGTGGGG 0: 1
1: 0
2: 0
3: 10
4: 97
1035459354_1035459361 13 Left 1035459354 7:159029726-159029748 CCTCCTTCATGACCTTGCTCTCC 0: 1
1: 0
2: 3
3: 32
4: 380
Right 1035459361 7:159029762-159029784 TCCTCAGCCCGCCTTCCGTGGGG 0: 1
1: 0
2: 0
3: 10
4: 97
1035459352_1035459361 15 Left 1035459352 7:159029724-159029746 CCCCTCCTTCATGACCTTGCTCT 0: 1
1: 0
2: 1
3: 33
4: 463
Right 1035459361 7:159029762-159029784 TCCTCAGCCCGCCTTCCGTGGGG 0: 1
1: 0
2: 0
3: 10
4: 97
1035459358_1035459361 -8 Left 1035459358 7:159029747-159029769 CCTGATCTGGTTGTCTCCTCAGC 0: 1
1: 0
2: 0
3: 10
4: 163
Right 1035459361 7:159029762-159029784 TCCTCAGCCCGCCTTCCGTGGGG 0: 1
1: 0
2: 0
3: 10
4: 97
1035459353_1035459361 14 Left 1035459353 7:159029725-159029747 CCCTCCTTCATGACCTTGCTCTC 0: 1
1: 0
2: 2
3: 29
4: 457
Right 1035459361 7:159029762-159029784 TCCTCAGCCCGCCTTCCGTGGGG 0: 1
1: 0
2: 0
3: 10
4: 97
1035459357_1035459361 1 Left 1035459357 7:159029738-159029760 CCTTGCTCTCCTGATCTGGTTGT 0: 1
1: 1
2: 1
3: 12
4: 212
Right 1035459361 7:159029762-159029784 TCCTCAGCCCGCCTTCCGTGGGG 0: 1
1: 0
2: 0
3: 10
4: 97
1035459355_1035459361 10 Left 1035459355 7:159029729-159029751 CCTTCATGACCTTGCTCTCCTGA 0: 1
1: 0
2: 1
3: 38
4: 1226
Right 1035459361 7:159029762-159029784 TCCTCAGCCCGCCTTCCGTGGGG 0: 1
1: 0
2: 0
3: 10
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035459361 Original CRISPR TCCTCAGCCCGCCTTCCGTG GGG Exonic
900291243 1:1924404-1924426 TCCTCAGCTCGCCCTCCCAGAGG - Exonic
901145155 1:7059931-7059953 TCCTCAGCACATCTGCCGTGTGG - Intronic
901883457 1:12207241-12207263 TGCCCAGCCAGCCTTCCGAGAGG - Exonic
906669654 1:47645233-47645255 TCCTCGGCCAGCCTTCCCTAGGG - Intergenic
907160523 1:52365912-52365934 TCCGTTGCCCACCTTCCGTGAGG - Intronic
908527417 1:65001427-65001449 TCCTCTGCTCGCCTTCCCGGAGG + Intergenic
912659467 1:111515395-111515417 TCCTCAGCCCTGCTTGTGTGAGG + Intronic
914803320 1:150975232-150975254 TCCTCCGCCCGCGCCCCGTGGGG - Intergenic
917512239 1:175678220-175678242 ACCCCAGCCCACCTTCCATGGGG - Intronic
919705314 1:200669955-200669977 GCCGCAGCCCGCTTTCCGGGCGG + Exonic
1064994656 10:21285967-21285989 TCCTCAGGCCACATTCCATGCGG + Intergenic
1065967433 10:30781227-30781249 CCCTCAGCCCTCCTTCGGTGGGG + Intergenic
1071518617 10:86315351-86315373 GCCTCAGCCCTCCTTGCCTGGGG - Intronic
1072249047 10:93567345-93567367 TCCTCATCCCAGCTTCCGTCGGG - Intronic
1075177690 10:120181289-120181311 TCCTCTGCCAGCCTGCGGTGTGG - Intergenic
1076384632 10:130047457-130047479 TCCAGAGCCCACCTTCCCTGAGG + Intergenic
1077330388 11:1981601-1981623 GCCTCGGTCCGCCCTCCGTGTGG + Intronic
1080446923 11:32345976-32345998 TCTTCAGGCCACCTTCCCTGTGG + Intergenic
1083683314 11:64361199-64361221 TGCTCAGCCCGAAGTCCGTGAGG - Exonic
1085474897 11:76783483-76783505 TCCCCAGCCCGCCCTCCGAAGGG - Intronic
1090987924 11:131788932-131788954 TCCTCACCCCTCCCTCCCTGCGG + Intronic
1202813367 11_KI270721v1_random:36780-36802 GCCTCGGTCCGCCCTCCGTGTGG + Intergenic
1091931852 12:4402746-4402768 TCCTCAGTCCGCCAGCCCTGGGG - Intergenic
1095463947 12:42470929-42470951 TCCTCAGCCAGTCTTCCAAGGGG + Intronic
1096513833 12:52145757-52145779 GCCTCAGCCTGCCTGCCCTGCGG - Intergenic
1101628659 12:106471444-106471466 GCTTCAGCTTGCCTTCCGTGAGG + Intronic
1104118434 12:125773293-125773315 TCCTCAGCCCGGCTGCGGGGCGG - Intergenic
1105699789 13:22927075-22927097 TCCGCAGCTCGTCCTCCGTGCGG - Intergenic
1108017286 13:46089320-46089342 TCATTACCCAGCCTTCCGTGTGG + Intronic
1114484972 14:23056957-23056979 TCCTCATCCCGCCTTCTCTCTGG - Intronic
1115748386 14:36461842-36461864 TCCTCATCCTGCCTTCCCTTAGG - Intergenic
1116885277 14:50214796-50214818 TCCTCAGGCCCCCCTCCCTGAGG + Intronic
1121738396 14:96234639-96234661 TCCTCAACCCGCCTGCCCTCTGG + Intronic
1127794875 15:62429021-62429043 TCATCAGCCTGACTTCCGTCTGG + Intronic
1127892715 15:63269430-63269452 TCCTCAACCCTCCTACCCTGTGG + Intergenic
1131259711 15:90882083-90882105 CCCTCAGCACCCCTTCCATGTGG + Exonic
1132387361 15:101409895-101409917 TCCTCAGCCTGCATTCTGGGAGG + Intronic
1133006302 16:2883486-2883508 TGCTCAGGCCGCCTCCTGTGGGG + Intronic
1137483177 16:48869442-48869464 TCCTCACCCCGCCTTCCCCCAGG + Intergenic
1138478006 16:57283576-57283598 TCCTCTGCCACCCTTTCGTGAGG - Intronic
1140306744 16:73809878-73809900 TCCCCACCCAGCCTTCCCTGTGG + Intergenic
1146411282 17:32587760-32587782 TCTTCAGCCTCCCTTCCCTGTGG + Intronic
1151686966 17:75653120-75653142 TCATCAGCCAGCCTTCCCTTTGG + Intronic
1152535967 17:80950556-80950578 TCCACACCCCGCACTCCGTGGGG + Intronic
1157563361 18:48663832-48663854 TCCTCCTCCCTCCTTCCCTGTGG + Intronic
1157763638 18:50282203-50282225 TACGCAGCGCGCCTTCAGTGTGG - Intergenic
1160755851 19:756908-756930 GCCTCAGCCTTCCTCCCGTGGGG - Exonic
1161511824 19:4676293-4676315 TCCTCTCCCCGCCTTCTGGGAGG - Exonic
1162508859 19:11105101-11105123 TCCCCAGCCCGCCTTTCCAGGGG + Intronic
1162697102 19:12484824-12484846 CCCTCCGCCCGCCTTCCCGGCGG + Intronic
1163222356 19:15930725-15930747 TCCACAGACCTCCTTCCATGCGG - Intronic
1163634892 19:18433284-18433306 CCGTCAGCCCGCCTGCCGGGTGG + Intronic
925164796 2:1709404-1709426 TCCTCACCCTGTCTTCTGTGGGG - Intronic
925435957 2:3837779-3837801 TCCTCAGCCGGCCAGCCGTGTGG + Intronic
925930744 2:8706008-8706030 TCCTGACCCGGCGTTCCGTGGGG - Intergenic
930095221 2:47561482-47561504 GCCTCAGCCCCCCTGCTGTGTGG - Intronic
932769373 2:74492077-74492099 TCCTCACCCCACCCTCCCTGGGG + Intronic
933886031 2:86720124-86720146 TCCCTCGCACGCCTTCCGTGTGG + Intronic
933924149 2:87076582-87076604 TCCCTCGCACGCCTTCCGTGTGG - Intergenic
934149644 2:89134106-89134128 TCCTCAGCCAGCTCTCCCTGAGG + Intergenic
934196581 2:89841912-89841934 TCCTCAGCCAGCTCTCCCTGAGG - Intergenic
934217651 2:90047922-90047944 TCCTCAGCCAGCTCTCCCTGAGG - Intergenic
935627299 2:105181682-105181704 GCCACAGCCTGCCTGCCGTGTGG + Intergenic
936151338 2:110023944-110023966 TCCTCACCCCACCTTCCCTGGGG + Intergenic
936193337 2:110347425-110347447 TCCTCACCCCACCTTCCCTGGGG - Intergenic
942450111 2:176103979-176104001 TCCTCAGCCCGCCTCCCTGGGGG - Intergenic
942463941 2:176188909-176188931 TCTGCAGCCCGCCTTCCCTCTGG + Exonic
1169867477 20:10217567-10217589 TCCCCAGCCCTCCCTCCCTGCGG + Intergenic
1171333016 20:24357927-24357949 TCCTCAGCTCCCCTTCCCTGAGG + Intergenic
1171373531 20:24676565-24676587 GCCACAGCCCGCTTTCCCTGGGG + Intergenic
1175836361 20:61998060-61998082 TCCTTAGCCCCCCTCCCGTGGGG + Intronic
1175923744 20:62462142-62462164 TCCTCAGGCCTCCTTCCTTCTGG + Intergenic
1180059065 21:45375435-45375457 CCCTCAGCTCCCCTTCCATGAGG - Intergenic
1182630885 22:31684286-31684308 TCCCCAGCCAGCCTTCTTTGAGG - Exonic
957939948 3:86991336-86991358 TCCGCAGCCAGCCTTCCCCGGGG - Intergenic
967022473 3:185534615-185534637 CCCTCATCCCACCTTCCCTGGGG + Intronic
971805757 4:31356084-31356106 TCCCCAGCCCCCCTTCCATTTGG + Intergenic
973774517 4:54231878-54231900 TCCTCAGTCCGCGTCCCGAGAGG - Intronic
985603037 5:844683-844705 TCCTCAGCCCGAGTTCCCTTTGG - Intronic
985703384 5:1386859-1386881 TCCTCAGACCTCCTTGCCTGGGG + Intergenic
990596266 5:57315252-57315274 TCCTCAGCATGGCCTCCGTGAGG + Intergenic
997605497 5:135173078-135173100 CCCTCAGCCAGCCTTGCATGGGG - Intronic
999459732 5:151747697-151747719 GCCTCAGCCAGCCTCCCGAGTGG + Intronic
1001772320 5:174305645-174305667 TCCTCAGCCAGCCTTCCTGAGGG - Intergenic
1004360456 6:14966265-14966287 TCCTCAGGCAGGCTTCAGTGTGG + Intergenic
1004627956 6:17394028-17394050 CCCGCACCCCGCCTTCCGAGCGG - Intronic
1006150209 6:31983016-31983038 TCCTAAGCACCCCTTCTGTGTGG - Intronic
1006156510 6:32015754-32015776 TCCTAAGCACCCCTTCTGTGTGG - Intronic
1007390204 6:41546416-41546438 TCCGGAGCCCGCCGTCCCTGCGG + Exonic
1008714429 6:54271835-54271857 TTCTTAGCACGCCTTCAGTGTGG + Intergenic
1014654096 6:124077709-124077731 GCCTCAGCCTGCCTCCCTTGTGG + Intronic
1018943706 6:168329543-168329565 TCCTGAGCCCTCCCTCCATGCGG + Intergenic
1019414545 7:921230-921252 TCCTCACCTGGCCTTCCCTGTGG + Intronic
1019492725 7:1322666-1322688 CCCTCAGCCCTCCTACCATGCGG + Intergenic
1019685888 7:2382034-2382056 TCCTGAGCCCGCCAGCCGTGGGG - Intergenic
1019917783 7:4144537-4144559 TCCCCAGCCCGCCATCTGGGAGG - Intronic
1024626509 7:51212530-51212552 TCCTCAGACCCCATTCAGTGTGG + Intronic
1030070076 7:105690524-105690546 TCCTCAGAAGGCCTTCCGTGAGG + Intronic
1035168846 7:157006790-157006812 TCCTGAGTCCGCATTCCTTGGGG - Intronic
1035459361 7:159029762-159029784 TCCTCAGCCCGCCTTCCGTGGGG + Exonic
1040906230 8:52472322-52472344 TCCTCAGCCTGCTCTCCATGCGG + Intergenic
1050635637 9:7609546-7609568 GCCTCAGCCCGTCTTCTGAGGGG + Intergenic
1057259546 9:93576325-93576347 TCCCCAGCCCGCCTTCCCGGCGG + Intergenic
1062150043 9:135013465-135013487 TCCTCAGCCTCCCTCTCGTGAGG + Intergenic
1185452731 X:291433-291455 GCCACACCCCGCCTTCCCTGTGG + Intronic
1188056777 X:25550533-25550555 TCCTCAGCCCTCCTTTGGGGAGG + Intergenic
1189501057 X:41559590-41559612 TACTCAGCCCTGCTTCCATGTGG - Intronic
1202581108 Y:26381531-26381553 ACCTCACCCAGCCTTCCATGTGG + Intergenic