ID: 1035459625

View in Genome Browser
Species Human (GRCh38)
Location 7:159030935-159030957
Sequence CCTTGGGGGCAGAGGCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1236
Summary {0: 1, 1: 0, 2: 6, 3: 108, 4: 1121}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035459610_1035459625 28 Left 1035459610 7:159030884-159030906 CCGCCTGCTCCCGTATCTGTGTT 0: 1
1: 0
2: 1
3: 9
4: 168
Right 1035459625 7:159030935-159030957 CCTTGGGGGCAGAGGCTGGAGGG 0: 1
1: 0
2: 6
3: 108
4: 1121
1035459611_1035459625 25 Left 1035459611 7:159030887-159030909 CCTGCTCCCGTATCTGTGTTGCC 0: 1
1: 0
2: 1
3: 6
4: 95
Right 1035459625 7:159030935-159030957 CCTTGGGGGCAGAGGCTGGAGGG 0: 1
1: 0
2: 6
3: 108
4: 1121
1035459615_1035459625 4 Left 1035459615 7:159030908-159030930 CCAGCAGATGGACAGAAACAGAA 0: 1
1: 0
2: 1
3: 31
4: 344
Right 1035459625 7:159030935-159030957 CCTTGGGGGCAGAGGCTGGAGGG 0: 1
1: 0
2: 6
3: 108
4: 1121
1035459613_1035459625 18 Left 1035459613 7:159030894-159030916 CCGTATCTGTGTTGCCAGCAGAT 0: 1
1: 0
2: 1
3: 13
4: 124
Right 1035459625 7:159030935-159030957 CCTTGGGGGCAGAGGCTGGAGGG 0: 1
1: 0
2: 6
3: 108
4: 1121
1035459612_1035459625 19 Left 1035459612 7:159030893-159030915 CCCGTATCTGTGTTGCCAGCAGA 0: 1
1: 0
2: 1
3: 11
4: 134
Right 1035459625 7:159030935-159030957 CCTTGGGGGCAGAGGCTGGAGGG 0: 1
1: 0
2: 6
3: 108
4: 1121
1035459609_1035459625 29 Left 1035459609 7:159030883-159030905 CCCGCCTGCTCCCGTATCTGTGT 0: 1
1: 0
2: 2
3: 13
4: 172
Right 1035459625 7:159030935-159030957 CCTTGGGGGCAGAGGCTGGAGGG 0: 1
1: 0
2: 6
3: 108
4: 1121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035459625 Original CRISPR CCTTGGGGGCAGAGGCTGGA GGG Intronic
900142693 1:1145234-1145256 CTCTCGGGGCAGAGGCTGGATGG - Intergenic
900365775 1:2311394-2311416 TCTGGGGGGCAGAGGATGGGCGG + Intergenic
900393163 1:2442643-2442665 CCTTGGGTGCAGAAGCAGCATGG + Intronic
900394232 1:2446567-2446589 CATTGGAGGCAGAGGGAGGAAGG + Intronic
900398419 1:2462711-2462733 CCCTGGGGGCTGAGGCAGTAGGG + Intronic
900457412 1:2783936-2783958 ACTTGGGGGCATTGGCTGCAGGG + Intronic
900547532 1:3236990-3237012 GCTGGGGGGCACAGGCCGGATGG + Intronic
900601931 1:3506411-3506433 CCCTGGGGGCAGGGGATGTAGGG - Intronic
900672823 1:3866329-3866351 CCTGGGAGGCAGAGGGTGCAGGG - Intronic
900823875 1:4910926-4910948 CCTGTGGGTGAGAGGCTGGAAGG + Intergenic
901029214 1:6297112-6297134 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
901368322 1:8773746-8773768 CCTGGGAGGCAGAGACTGCAGGG + Intronic
901459652 1:9383996-9384018 CCTGGGAGGCAGAGGCTGAAAGG - Intergenic
901520875 1:9783915-9783937 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
901870593 1:12136571-12136593 CCTGGGGGACAGAGGTTGCAGGG + Intronic
902669785 1:17965055-17965077 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
902891075 1:19444080-19444102 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
902921015 1:19665819-19665841 CCCGGGGGGCAGCGGCTGGGTGG + Exonic
902975322 1:20084257-20084279 CTTTGCAGGCAGAGGCTGGGCGG - Intronic
903034819 1:20486541-20486563 CCTGGGGGGCAGATGCTGCGGGG + Intergenic
903366327 1:22807545-22807567 CCATGGGGGTAGAGGCTGGGAGG - Intronic
903397730 1:23014916-23014938 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
903447368 1:23431044-23431066 CCTTCTGGGCAGAGGCTGCCTGG + Exonic
903527465 1:24002700-24002722 CTTGGGGGGCTGAGGCGGGAAGG + Intergenic
903539911 1:24091016-24091038 CATTGTGGGCAGGGGCTGAAAGG - Intronic
903600280 1:24533157-24533179 CCACCGGGGGAGAGGCTGGAGGG - Exonic
903647656 1:24904750-24904772 CCCTGAGGAAAGAGGCTGGAGGG - Intronic
903672952 1:25047193-25047215 TCATGAGGGGAGAGGCTGGATGG - Intergenic
903939187 1:26917180-26917202 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
904461318 1:30682037-30682059 CTGTGGCGGCAGAGGCGGGATGG + Intergenic
904496542 1:30890229-30890251 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
904525869 1:31133422-31133444 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
904624036 1:31792237-31792259 CCTGGTGGGCAGGGGCTGGAAGG + Exonic
904690119 1:32287525-32287547 CCCAGGAGGCAGAGGCTGCAGGG - Intergenic
904864827 1:33570241-33570263 CCTAGGAGGCAGAGGTTGCAGGG - Intronic
905065462 1:35177458-35177480 CCTTGGAGGCTGAGGTGGGAGGG - Intronic
905204720 1:36336832-36336854 GGTTAGGGGGAGAGGCTGGAAGG - Intergenic
905419741 1:37832928-37832950 CCTGGGCGGCAGAGGTTGCAGGG + Intronic
905557436 1:38898226-38898248 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
905991963 1:42345594-42345616 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
906064248 1:42968784-42968806 CATTTGGGGCTGAGGCTGGGAGG + Intergenic
906180107 1:43810738-43810760 CCTTGGGAGCAGAGGGGCGAGGG + Intronic
906294027 1:44638078-44638100 TTTTGGGGGCAGAGGCAGTAGGG - Intronic
906438342 1:45816751-45816773 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
906541691 1:46591680-46591702 TGTTGGGTGCTGAGGCTGGAAGG - Intronic
906684637 1:47755609-47755631 CCCTGGTGGCAGCTGCTGGATGG + Intergenic
906982139 1:50642914-50642936 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
907262803 1:53234060-53234082 CCTTGAGGGCAGAGGCCCCAGGG + Intronic
908204549 1:61832170-61832192 ACTTGGGGGTAGAGGGTAGAAGG + Intronic
908304653 1:62799952-62799974 CCATGGAGGCAGAGAGTGGAAGG - Intronic
908725832 1:67175931-67175953 CTTGGGAGGCTGAGGCTGGAAGG - Intronic
908733084 1:67247378-67247400 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
908789096 1:67763638-67763660 CCCTGGAGGCTGAGGCAGGAGGG - Intronic
909446436 1:75754281-75754303 CCCCGGGGGCAGAGGTTGCAGGG - Intronic
909447226 1:75760450-75760472 CTTTGGGGGCTGAGGCGGGAGGG + Intronic
909649269 1:77955394-77955416 CCTTGGGTGCAGGAGCTGGCAGG + Intronic
909660458 1:78076293-78076315 CTTTGGGGCCAGAAGATGGAGGG - Intronic
910262533 1:85306124-85306146 CCTTGGGGGGAAAGCCAGGAAGG - Intergenic
910568508 1:88674581-88674603 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
910572794 1:88724645-88724667 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
911200705 1:95040559-95040581 CCTTGGGCCTAAAGGCTGGAAGG + Intronic
911216757 1:95203332-95203354 ACTGGGAGGCAGAGGCTGCAGGG - Intronic
911543931 1:99192710-99192732 ACTTGAGGGTAGAGGGTGGAAGG + Intergenic
912220767 1:107672191-107672213 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
912818921 1:112851257-112851279 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
912828376 1:112927048-112927070 CCTCGGTGGCTGAGGCTGCAGGG + Intronic
912965865 1:114236882-114236904 CCTGGGAGGCAGAGGTTGAAGGG + Intergenic
913253902 1:116937172-116937194 CCTTGGGAGCAGAGCATGGCTGG + Intronic
913285628 1:117224059-117224081 CCTGGGAGGCAGAGGTTGTAGGG + Intergenic
914264100 1:146022802-146022824 CTTTGGGAGCTGAGGCAGGAGGG + Intergenic
914726756 1:150334435-150334457 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
914849633 1:151304729-151304751 CCTGGGAGGCGGAGGCTGCAGGG - Intronic
914893330 1:151648128-151648150 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
915480756 1:156183207-156183229 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
915526744 1:156480777-156480799 CCTGGGGGGAAGGGGCCGGAAGG + Intronic
915527596 1:156485625-156485647 CTTGGGAGGCTGAGGCTGGAAGG - Intronic
915531144 1:156502869-156502891 CCTTGGGGGAAGAGGCAGATGGG - Intergenic
915579911 1:156807376-156807398 CCTAGGAGGCAGAGGGTAGAGGG - Intronic
916407485 1:164511594-164511616 CCTCTGGGGCTGAGCCTGGACGG - Intergenic
916796136 1:168169255-168169277 CCCTGGAGGCAGAGGTTGCAGGG - Intergenic
916857239 1:168762646-168762668 CGTTGGTTGCAGAAGCTGGAAGG + Intergenic
917624919 1:176835885-176835907 TCTTGGGGGCAGAACCTGGGGGG - Intronic
917802190 1:178581048-178581070 TCTAGGGGTCAGAGGCTGGCAGG + Intergenic
918561462 1:185872543-185872565 TGTTGGGGGGAGAGGATGGATGG + Intronic
919134272 1:193488835-193488857 CTTTGGGGGTAGAAGCTGGGAGG - Intergenic
919153075 1:193724769-193724791 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
919619289 1:199846966-199846988 CCCTGGAGGCAGAGGTTGCAGGG + Intergenic
919853127 1:201687252-201687274 CCCAGGGGGAAGTGGCTGGAAGG + Intronic
919857655 1:201716768-201716790 ACTTTGGGGCTGAGGCAGGAGGG + Intronic
919887101 1:201942509-201942531 CCTTGGAGGGAGACCCTGGAGGG + Intronic
919937058 1:202260407-202260429 CCCGGGAGGCAGAGGCTGCAGGG - Intronic
920129864 1:203723803-203723825 CTTTGGGGGCCTTGGCTGGAGGG + Intronic
920300503 1:204985888-204985910 CCTTCGGGACAGAGGCAGGCTGG - Intronic
920320456 1:205117883-205117905 CCTGTGAGGCAGAGGTTGGAGGG - Intronic
920495116 1:206449001-206449023 CCATGGGGAAAGAGGCTTGAGGG + Intronic
920667963 1:207980191-207980213 CCTTGGAGGCAGAGGTTGCAGGG - Intergenic
920717667 1:208356001-208356023 GCTTGGGGTGGGAGGCTGGATGG + Intergenic
921388966 1:214600214-214600236 CTTTGGGGGCTGAGGCTGGTGGG + Intergenic
921649832 1:217664363-217664385 CCTGGGAGGCAGAGGTTGTAGGG - Intronic
922042272 1:221908095-221908117 CCTTGGAGGCTGAGGCCGGAGGG + Intergenic
922087399 1:222363900-222363922 ACATGGGAGCAGATGCTGGAAGG + Intergenic
922204187 1:223432244-223432266 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
922239249 1:223744783-223744805 CCTGGGAGGCAGAGGTTGGGAGG + Intronic
922351745 1:224739718-224739740 TCCTGGGAGCGGAGGCTGGAAGG + Exonic
922364854 1:224854182-224854204 CCATGGGGGCTGAGGAGGGAGGG + Intergenic
922631237 1:227113940-227113962 CCTGGGAGGCTGAGGCTGCAGGG + Intronic
922804828 1:228379872-228379894 CCTGGGGGGCTGGGGCTGCAGGG + Intergenic
922976229 1:229785655-229785677 CCTTGGGGACAGGAGCTGCAGGG + Intergenic
923080517 1:230649333-230649355 GTTTGAGGGCAGGGGCTGGAGGG + Intronic
923084144 1:230689642-230689664 TGTTGGGGGCAGTGGGTGGAAGG - Intronic
923374752 1:233349859-233349881 CCCTGGAGGCAGAGGTTGCAGGG + Intronic
923564983 1:235069918-235069940 CCTAGGGGACAGGGACTGGAGGG - Intergenic
923677230 1:236090477-236090499 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
923954353 1:238997929-238997951 CCTTGGGGGGAGAGGTGGGAGGG - Intergenic
924057817 1:240141441-240141463 CCGTGGGGGCAGAGTTTGCAGGG - Intronic
924143318 1:241048472-241048494 CCTGTGGGTGAGAGGCTGGAAGG - Intronic
924210241 1:241757724-241757746 TCTGGGGGGCTGAGGCAGGAGGG - Intronic
924300358 1:242631850-242631872 CCTGGGGGACAGAGGTTGCAGGG - Intergenic
924702324 1:246466521-246466543 CCTTGAGGGTGGAGGTTGGAAGG + Intronic
1062772505 10:114029-114051 CCTGGGAGGCAGAGGTTGCAAGG + Intergenic
1062796489 10:348425-348447 GTGTGGAGGCAGAGGCTGGATGG - Intronic
1062845375 10:699255-699277 TCATGGAGTCAGAGGCTGGAGGG - Intergenic
1062923564 10:1297807-1297829 CCATGGAGGCAGGGGCTGGAGGG + Intronic
1063472605 10:6300251-6300273 CCTTGTGGGCAAAGGCAGGAAGG - Intergenic
1063744173 10:8860994-8861016 CCTGGGAGGCCGAGGCTGCAGGG - Intergenic
1064350154 10:14568768-14568790 ACCTGGTGGAAGAGGCTGGAGGG + Intronic
1064415177 10:15143250-15143272 TCTTGGGGCCACAGGCTGGGTGG + Intronic
1064764498 10:18657687-18657709 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1064906623 10:20353505-20353527 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1065306536 10:24374433-24374455 CCTTGGGTGCAGGCGCTAGAGGG - Intronic
1065387253 10:25146112-25146134 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1065579535 10:27156573-27156595 CCCAGGAGGCAGAGGCTGCAGGG - Intronic
1065607673 10:27436162-27436184 ACTTGGTGGCTGAGGCAGGAGGG + Intergenic
1065737213 10:28765045-28765067 CTTGGGAGGCTGAGGCTGGAGGG + Intergenic
1065883405 10:30057635-30057657 CCTTTGCTGCAGAGACTGGAAGG - Intronic
1065885331 10:30071700-30071722 CCTGGGGGGCGGAGGTTGCAAGG + Intronic
1065918509 10:30371388-30371410 CCTGGAAGGCAGAGGCTGCAGGG + Intronic
1065974551 10:30830909-30830931 CCTGGGTGGAGGAGGCTGGAGGG + Intronic
1065980327 10:30888524-30888546 ACTTGAGGGTAGAGGGTGGAGGG - Intronic
1066084374 10:31962243-31962265 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1066275759 10:33866682-33866704 CTTGGGAGGCTGAGGCTGGAGGG + Intergenic
1066372129 10:34826130-34826152 CCTGTGCTGCAGAGGCTGGAAGG + Intergenic
1067097574 10:43312544-43312566 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1067105746 10:43365050-43365072 CCTTGGGTGATGAGACTGGAAGG + Intergenic
1067435404 10:46273164-46273186 CCTGGGGTGCAGGGGCTGGCAGG - Intergenic
1067582201 10:47452854-47452876 CCTTGGGTGCAGGGGCTGGCGGG - Intergenic
1068009168 10:51426203-51426225 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1068425577 10:56859334-56859356 GCTGATGGGCAGAGGCTGGAAGG - Intergenic
1068427921 10:56891740-56891762 CCTGGGAGGCAGAGGTTGGGAGG - Intergenic
1068756514 10:60660674-60660696 TCTCTGGGGTAGAGGCTGGAAGG + Intronic
1069477816 10:68751101-68751123 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1069616387 10:69809019-69809041 CCTTGGGAGTAGAGGATGGGAGG - Intronic
1069861728 10:71475778-71475800 CCTGAGGGGCGGAGGCTGGAAGG + Intronic
1070004454 10:72409613-72409635 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1070055130 10:72927213-72927235 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1070140439 10:73734077-73734099 GCTTTGGGGCAGAGCCTGAAGGG - Intergenic
1070302377 10:75213152-75213174 CCCAGGAGGCAGAGGCTGCAGGG - Intronic
1070355250 10:75633577-75633599 TCTTCGGGGCTGGGGCTGGAAGG - Intronic
1070461408 10:76674102-76674124 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1070779692 10:79130323-79130345 CCTTGGGGTTGGAGGGTGGAGGG - Intronic
1071206163 10:83281518-83281540 CCTAGGGGGCAGATGCTCAAGGG + Intergenic
1071328188 10:84536975-84536997 CTTTGGGGTCAGAAACTGGATGG - Intergenic
1071333965 10:84586773-84586795 CCATGGTGGCAGAGGTGGGATGG - Intergenic
1071367985 10:84920361-84920383 ACTTGAGGGCAGAGGGTGGGAGG + Intergenic
1072125196 10:92439384-92439406 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1072682293 10:97516207-97516229 TCCTGGGAGCTGAGGCTGGAAGG + Intronic
1073182982 10:101597128-101597150 CCAAGGGGGCTGAGGCTGAAGGG + Intronic
1073632016 10:105158663-105158685 GTTGGGGGGCAGAGGCAGGAGGG + Intronic
1073701032 10:105926626-105926648 CCCGGGAGGCAGAGGCTGCAGGG + Intergenic
1074111685 10:110427168-110427190 CCTCGGGGGTAGAGGCAGGAAGG + Intergenic
1074184018 10:111085851-111085873 ACTTTGGGGAACAGGCTGGAGGG + Intergenic
1074370978 10:112900646-112900668 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1074578208 10:114690755-114690777 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1075532165 10:123238817-123238839 GACTGGGGGCAGAGGGTGGATGG - Intergenic
1075565421 10:123500054-123500076 CCTTGGGGTGAGAAGCTGGTGGG - Intergenic
1075767708 10:124907473-124907495 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1076025270 10:127107063-127107085 CTTTGAAGGCAGAGGCGGGAGGG - Intronic
1076396016 10:130137808-130137830 CCTGGGAGGCGGAGGCTGCAGGG - Intronic
1076422402 10:130340667-130340689 GGATGGAGGCAGAGGCTGGAGGG - Intergenic
1076500997 10:130936021-130936043 CCTGGGGGCCTGAGGATGGAGGG + Intergenic
1076540314 10:131210332-131210354 CCCTGGGGGCAGAGGGTTGGGGG - Intronic
1076830535 10:132992224-132992246 CCTCGAGGACAGAGGGTGGACGG + Intergenic
1077034873 11:489766-489788 CCCGGGGGGCAGGGGCCGGAGGG + Intronic
1077066891 11:645085-645107 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1077109074 11:854202-854224 CCTGGGGAGCAGCGTCTGGAAGG - Intronic
1077130233 11:968370-968392 CCGCGGGAGCAGAGGCTGGTCGG + Intronic
1077254249 11:1573325-1573347 CCTGGGGGGCCCAGGCTGGCTGG - Intergenic
1077357364 11:2124676-2124698 GCGTGGGGGCAGAGACTGGAAGG - Intergenic
1077357374 11:2124723-2124745 GCGTGGGGGCAGAGACTGGACGG - Intergenic
1077405204 11:2379499-2379521 ACCTAGGGGCAGAGGCTGAAGGG + Intronic
1077991224 11:7414117-7414139 CCTTGAGGGCAGAGATTAGACGG + Intronic
1078201093 11:9183973-9183995 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1078280341 11:9894606-9894628 CCCAGGAGGCAGAGGCTGTAGGG + Intronic
1078704293 11:13724472-13724494 CCTAGGAGGCAGAGGTTGCAGGG + Intronic
1079123141 11:17699293-17699315 GATTTGGGGCAGAGGCTGGTGGG - Intergenic
1079728451 11:23907609-23907631 ACTTGAGGGCAGAGGGTGGGAGG + Intergenic
1080386809 11:31815313-31815335 TCTTGGGGGCAGAGGTTACAGGG - Intronic
1080641254 11:34159789-34159811 TCTGAGGGGCAGAGGCTGCAGGG + Intronic
1080657793 11:34271373-34271395 CCCTGGAGCCAGAGTCTGGATGG - Intronic
1080678814 11:34453937-34453959 CCTTTGGGGCAGAGGGTACAAGG + Intronic
1081099977 11:38989324-38989346 CCTGGGAGGTAGAGGCTGCAGGG - Intergenic
1081499421 11:43651654-43651676 CCTAGGAGGCAGAGGTTGCAGGG - Intronic
1081825644 11:46048692-46048714 CCCGGGAGGCAGAGGCTGCAGGG + Intronic
1081827426 11:46070404-46070426 CCCTGGAGGCAGAGGCTGCAGGG - Intronic
1081947435 11:47009719-47009741 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1082806351 11:57454128-57454150 CCTTGGGGGCAGAGGTTGCCCGG - Intergenic
1083259446 11:61515246-61515268 CCCTGGGGGCAGAGGCAGTGGGG - Intergenic
1083297323 11:61722022-61722044 CCTCAGGGGCTGAGACTGGAGGG - Intronic
1083600772 11:63946287-63946309 CCCAGGCGGCAGAGGCTGCAAGG - Intronic
1083658882 11:64242994-64243016 CCCGGGAGGCAGAGGCTGCAGGG + Intronic
1083880445 11:65545845-65545867 CTATGGGGGCTGAGGCTGGCCGG - Intronic
1083922865 11:65789893-65789915 CCTTGGGGAGAGAGGCTGATGGG - Intronic
1084118409 11:67055280-67055302 CCTTGGGTGGCAAGGCTGGAAGG - Intergenic
1084222138 11:67688866-67688888 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1084287860 11:68143270-68143292 CCTTGGCAGCAGGAGCTGGATGG + Intergenic
1084379133 11:68799645-68799667 CCTGGGGGGCTGAGGTTGGGAGG + Intronic
1084422456 11:69067139-69067161 GCTACGGGGCAGAGGCAGGAGGG - Intronic
1084551583 11:69846445-69846467 CATGGGGGCCAGAGGCTGGGAGG + Intergenic
1084568639 11:69945838-69945860 CCACGGGGGCAGAGGTGGGAGGG + Intergenic
1084598505 11:70131401-70131423 CCCTGGAGGCAGAGGTTGCAGGG - Intronic
1084873672 11:72115045-72115067 CCTTGAGGGCAGGGACTGAATGG + Intronic
1084902989 11:72324113-72324135 CCTTGGGGGATGAGTCTGGAAGG + Intronic
1085052573 11:73387424-73387446 ACTTTGGGGCAGAAACTGGAAGG + Intronic
1085273755 11:75285316-75285338 CCTTGGGGGCAGAGTCCAGCTGG + Intronic
1085296459 11:75434355-75434377 CGCTGGGGCCAGAGTCTGGATGG + Intergenic
1085359350 11:75872462-75872484 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1085466027 11:76723912-76723934 CCTTGGCTGCAGGGGCTGCAGGG - Intergenic
1085508986 11:77075838-77075860 TCTTGGGGGTAGTGACTGGAAGG - Intronic
1086118749 11:83283884-83283906 CCTGGGAGGCACAGGCTGCAGGG + Intronic
1086476296 11:87178499-87178521 CCTGGGAGGCAGAGGCTGCAGGG - Intronic
1086723396 11:90149508-90149530 CCTCGGAGGCAGAGGTTGCAGGG - Intronic
1087533758 11:99416738-99416760 GCAAGGAGGCAGAGGCTGGAGGG + Intronic
1087789376 11:102391082-102391104 CCTTGGCAGCAGAGCCGGGATGG - Intergenic
1087940156 11:104087099-104087121 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1088303565 11:108384695-108384717 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
1088585565 11:111357595-111357617 CCATGGGGCCAGGGGCTGCAGGG + Exonic
1088622241 11:111697746-111697768 CTTTGGGTGCTGAGGCAGGAGGG + Intronic
1088935057 11:114391094-114391116 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1089033189 11:115355460-115355482 ACTTGAGGGTAGAGGCTGGGAGG + Intronic
1089064758 11:115654085-115654107 CCTGGGCGGCCGAGGCTGGGTGG - Intergenic
1089218555 11:116851478-116851500 ACTTAGGGGCAGAGGCAGGATGG + Intronic
1089237136 11:117038972-117038994 CCTGGGAGGCGGAGGCTGCAGGG + Intronic
1089258258 11:117205565-117205587 ACTTCGGGGTAGAGGCTGGGAGG - Exonic
1089372381 11:117970667-117970689 CCTTGGGGCAAGAGGCTGTATGG - Intergenic
1089381599 11:118036675-118036697 CCATGGGGGCAGAGGGTAGCAGG + Intergenic
1089396594 11:118140212-118140234 CCTTGTGGCCAGAGGCTGTGAGG - Intronic
1089431986 11:118432903-118432925 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1089589432 11:119531151-119531173 CCCTGGGTGCTGAGGCTGGGAGG - Intergenic
1089630315 11:119780124-119780146 CCCTGGAGGCAGGGGCTGGGGGG + Intergenic
1089642952 11:119859620-119859642 CCTGGGGTGCTGAGGCTGGCTGG + Intergenic
1089663661 11:120002600-120002622 CCTTGAGGCCAGAGCTTGGAGGG - Intergenic
1089740753 11:120580642-120580664 CCTAGGAGGCAGAGGTTGCAGGG - Intronic
1089776272 11:120838860-120838882 CCTGGGAGGCAGAGGTTGGAAGG - Intronic
1090404295 11:126467781-126467803 CCTTGAGGCCAGAGGCCAGAGGG + Intronic
1090405798 11:126475270-126475292 CCATGCAGGCTGAGGCTGGAAGG - Intronic
1090441539 11:126728937-126728959 CTTTCGGGGCAGAGGGAGGAGGG + Intronic
1090675064 11:128984297-128984319 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
1090880023 11:130825193-130825215 CCTTGGGGGAAGGGACTGGTGGG - Intergenic
1091302251 11:134515111-134515133 CGTGCGGGGCAGAGGCGGGAGGG - Intergenic
1091365434 11:135016082-135016104 GCTTGGGGGCACTGGCTGGGTGG - Intergenic
1091898744 12:4125205-4125227 CGTGGGAGGCAGAGGCTGCAGGG + Intergenic
1091929702 12:4385587-4385609 CCTCTGGGGCAGAGCTTGGAAGG - Intergenic
1093107327 12:15104360-15104382 CCTGGGAGGCAGAGGCTGCAGGG - Intergenic
1093166212 12:15806812-15806834 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1093180955 12:15966386-15966408 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1094110796 12:26860155-26860177 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1095473104 12:42557282-42557304 GCTTGGGGACAGTGCCTGGACGG + Intronic
1095891960 12:47243379-47243401 CCCAGGGGGCAGAGGTTGCAGGG - Intergenic
1095983150 12:47984035-47984057 CCCTGGGGGCAGGGGCTGGGAGG - Intronic
1096120900 12:49089012-49089034 CCTTGGTGGCAGGGCCTGGATGG - Intergenic
1096155875 12:49341378-49341400 CCGTGATGGCAGAGGCAGGAGGG - Intergenic
1096275890 12:50207812-50207834 CCAGGGGGGCAGAGGTTGCAGGG + Intronic
1096367154 12:51037796-51037818 CCTGGGAGGCTGAGGCAGGAGGG + Intergenic
1096519663 12:52177513-52177535 CCCTGGGGGCACAGGCTGGAAGG - Intronic
1097023642 12:56037655-56037677 CCATGAGAGCAGAGACTGGAAGG + Exonic
1097065224 12:56315812-56315834 CCCTGGGAGCAGAGGTGGGACGG - Exonic
1097078120 12:56410173-56410195 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1097116493 12:56701264-56701286 CTTGGGAGGCTGAGGCTGGAAGG - Intergenic
1097199402 12:57265708-57265730 CCTGGGAGGCTGAGGCTGTAAGG - Intronic
1098403098 12:70094551-70094573 CCTTAGTGGCAGAGACTGGTAGG - Intergenic
1098966626 12:76797185-76797207 CCTGGGAGGCAGAGGTTGTAGGG + Intronic
1099600143 12:84725159-84725181 ACTTGGAGGCAGAGGTTGCAGGG - Intergenic
1099640788 12:85280664-85280686 CTTTGGGGGCGGAGGGCGGAGGG + Intronic
1100259015 12:92914166-92914188 CCATGGGGGCATGGGCTGGTGGG - Intronic
1100685969 12:96986071-96986093 CCTTTGGGGAAGAGGGAGGAAGG + Intergenic
1100836467 12:98571474-98571496 CCTGGGAGGCAGAGGCTGTGTGG - Intergenic
1101027291 12:100623550-100623572 CTTTGGGGGCAGATGCTTCATGG + Exonic
1101333656 12:103777630-103777652 GCATGGGGGGAAAGGCTGGAGGG + Exonic
1101892047 12:108725909-108725931 CCTGGGAGGCAGAGGCTGCAGGG - Intronic
1102067422 12:109988775-109988797 CCCGGGAGGCAGAGGCTGCAGGG + Intronic
1102100016 12:110270907-110270929 CCTTGGGGGGTGAGGAAGGAGGG + Intergenic
1102243122 12:111337957-111337979 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
1102500617 12:113349739-113349761 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1102596647 12:113998043-113998065 CTTGGGAGGCAGAGGCAGGAGGG - Intergenic
1102855577 12:116290255-116290277 CCTTGAGGGCAGGGTCTTGAGGG + Intergenic
1102934716 12:116886746-116886768 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1103133407 12:118487764-118487786 TGTTGGGGCCAGAGGCTTGAGGG + Intergenic
1103449557 12:121018792-121018814 CCTCGGAGGCAGAGGTTGCAGGG + Intergenic
1103867143 12:124062316-124062338 ACTTGGGGGCAGAAGAGGGAAGG - Intronic
1104001664 12:124864062-124864084 CCGTGGGGGCAGCGGCAGCATGG - Intronic
1104017661 12:124971444-124971466 CCCTTGGGGCTTAGGCTGGAAGG - Intronic
1104188367 12:126454474-126454496 CCATGGGGTCAGAGGAAGGATGG - Intergenic
1104707479 12:130958273-130958295 CCCAGGGGGCAGAGGTTGCAGGG - Intronic
1105768460 13:23584224-23584246 ACTTGGGGGAAAAGGGTGGAAGG - Intronic
1105981046 13:25516550-25516572 CTTTTGGGGCAGTGGCTGCATGG + Intronic
1106040859 13:26091488-26091510 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1107014544 13:35697554-35697576 CATGGAGGGCAGAGGGTGGAGGG + Intergenic
1107246637 13:38304789-38304811 CCTTGAAGACAGAGGTTGGATGG - Intergenic
1107466908 13:40659237-40659259 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1107485838 13:40826873-40826895 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1107549802 13:41464139-41464161 CCCTGGGCCCAGAGGCTGGCTGG - Intronic
1107697853 13:43018261-43018283 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1107864777 13:44693127-44693149 CAGTGGGGGCAGTGGCTGTAGGG + Intergenic
1107887198 13:44883387-44883409 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1107939554 13:45371794-45371816 CCTGGGAGGCAGAGGCTGCAGGG + Intergenic
1108778616 13:53798906-53798928 TATTGGGGGCAGAGGATGGAAGG + Intergenic
1108807806 13:54181413-54181435 ACTTGTGGGCAGAGGGTGGGAGG - Intergenic
1109081348 13:57905299-57905321 ACTGGAGGGCAGAGGGTGGAAGG + Intergenic
1109198626 13:59407002-59407024 ACTTGAGGGCAGAGGGTAGAAGG - Intergenic
1109206331 13:59487023-59487045 CGTTGGAGGTATAGGCTGGAAGG - Intergenic
1110080465 13:71303661-71303683 CCCAGGAGGCAGAGGCTGCACGG + Intergenic
1110263450 13:73512482-73512504 CCTTGGAGGCTGAGGTGGGAAGG - Intergenic
1110482089 13:75990544-75990566 ACTTGAGGGCAGAGGGTGGGAGG + Intergenic
1110559224 13:76892315-76892337 ACTTGAGGGTAGAGGTTGGATGG - Intergenic
1111535736 13:89600179-89600201 CCTGGGAGGCAGAGGTTGTAGGG + Intergenic
1112150978 13:96763413-96763435 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1112558197 13:100488528-100488550 CCTTGGAGGCTGAGGCTGGAGGG + Intronic
1112746369 13:102531647-102531669 CCTGGGAGGCAGAGGTTGTAGGG + Intergenic
1112832034 13:103464797-103464819 CTCTGGGGGCAGGGGCTGGGAGG + Intergenic
1113093138 13:106635851-106635873 ACGAGGGAGCAGAGGCTGGACGG - Intergenic
1113737610 13:112689849-112689871 CCCTGGGGGCAGAGGGCAGAGGG - Intergenic
1113949820 13:114065725-114065747 CCCAGAGGTCAGAGGCTGGAGGG + Intronic
1113958648 13:114113057-114113079 ACTTGGGGGCAGGAGCTGGAGGG + Intronic
1114261497 14:21039997-21040019 CCTTTGGAGTGGAGGCTGGATGG - Intronic
1114290816 14:21286916-21286938 TTTGGGAGGCAGAGGCTGGAAGG + Intergenic
1114479453 14:23023261-23023283 CCTGGTGTGCAGATGCTGGAAGG + Intronic
1114520635 14:23332667-23332689 CCTGGGGGGCAGAGCTTGCAGGG - Intergenic
1114641093 14:24221671-24221693 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1115148585 14:30256470-30256492 GCTTTGGGGCAGAGACTGTAGGG + Intergenic
1116805232 14:49488076-49488098 ACTTGAGGGTAGAGGGTGGAAGG - Intergenic
1117356320 14:54926860-54926882 CCCTGGAGGCAGAGGTTGTAGGG - Intergenic
1117381371 14:55167010-55167032 CTTTGGGGGCCGAGGCAGGCAGG + Intronic
1118528107 14:66668954-66668976 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1118779136 14:68994650-68994672 GCTTGCTGGCTGAGGCTGGAAGG - Intergenic
1118997392 14:70848940-70848962 ACTTGGAGGCAGAGGCTGCAGGG + Intergenic
1119148193 14:72334789-72334811 CCCTGTGGGGAGATGCTGGAGGG - Intronic
1119391980 14:74296903-74296925 CTCAGGGGGCAGAGGCAGGATGG + Intronic
1119430901 14:74567451-74567473 CCTCAGGGGCAGAGGCGGGGTGG + Intronic
1119666884 14:76491356-76491378 CGCTGGGGGCAGAGGTTGCAGGG - Intronic
1119693513 14:76694937-76694959 CCCTGGGGGCAGAGCCTGTGGGG + Intergenic
1121047094 14:90796155-90796177 CCTCTGGGGCAGAGGCTGGATGG + Intronic
1121091983 14:91189211-91189233 CTTTGTGGACGGAGGCTGGAGGG + Intronic
1121888332 14:97565115-97565137 TCTTGGGGACAGAGTGTGGAGGG + Intergenic
1122215166 14:100198664-100198686 CCCTGGAGGCAGAGGTTGCAGGG + Intergenic
1122299153 14:100722322-100722344 ACCTGGGGGCAGAGGGTGGAGGG - Intergenic
1122429838 14:101633349-101633371 CCTTCGGGGAAGATGCGGGAGGG + Intergenic
1122568947 14:102680727-102680749 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1122703680 14:103607079-103607101 AGGTGGAGGCAGAGGCTGGAGGG + Intronic
1122710673 14:103655149-103655171 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1122778610 14:104134242-104134264 CCTTGGCGACAGTGGATGGACGG - Intergenic
1122784071 14:104155852-104155874 CCCTGTGGGAAGAGGGTGGAGGG + Intronic
1122863438 14:104592985-104593007 ACCTGGGGCCAGAGGCTGGAAGG + Exonic
1122996471 14:105267972-105267994 CCATGGAGGCTGAGGCTGGCAGG + Intronic
1123043844 14:105501888-105501910 CCTTGAGGGATGAGGCTGGTTGG + Intergenic
1123047635 14:105526593-105526615 CAGTGGCGGCAGAGGCTGGGCGG + Exonic
1123465364 15:20510973-20510995 CCTGGGTGGCAGAGGTTGCAGGG + Intergenic
1123652752 15:22490058-22490080 CCTGGGTGGCAGAGGTTGCAGGG - Intergenic
1124083264 15:26520443-26520465 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1124237671 15:28004010-28004032 CCTGGGTGGCAGCGGCTGGACGG - Intronic
1124351400 15:28958171-28958193 ACTTGTGGGTAGAAGCTGGAAGG + Intronic
1124906263 15:33871490-33871512 CCTGGGAGGCAGAGGCCGCAGGG + Intronic
1124930241 15:34112665-34112687 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1125443608 15:39729882-39729904 ACTTGAGGGCAGAGGGTGGTAGG + Intronic
1125447850 15:39776999-39777021 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1125570144 15:40710424-40710446 CCCGGGGGGCAGAGGTTGCAGGG + Intronic
1125925295 15:43558301-43558323 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1126019584 15:44387097-44387119 CCCAGGAGGCAGAGGCTGCAGGG + Intronic
1126109787 15:45168464-45168486 CCCTGGCCACAGAGGCTGGAGGG - Intronic
1126283403 15:46983866-46983888 ACTTGAGGGCAGAGGGTGGAAGG - Intergenic
1126625262 15:50680156-50680178 CCCGGGAGGCAGAGGCTGCAGGG + Intronic
1127246149 15:57177343-57177365 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1127436711 15:58964984-58965006 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1127444420 15:59046267-59046289 CCCTGGAGGCTGAGGCTGCAGGG - Intronic
1127672859 15:61212473-61212495 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1127971783 15:63967613-63967635 CCCAGGAGGCAGAGGCTGCAGGG + Intronic
1128085512 15:64883795-64883817 CCTTGGGAGCAGATGCTGATGGG + Intronic
1128104642 15:65034524-65034546 CCTTGGGGGTAGGGGCTGAAGGG + Intergenic
1128371726 15:67044599-67044621 GCTTGAGGCCAGAGGCTGGCAGG - Intergenic
1128526248 15:68414309-68414331 CCTGGGGGGACGGGGCTGGAGGG + Intronic
1128547898 15:68579719-68579741 CATGGGCGGCAGAGGCTGGCAGG - Intronic
1129277889 15:74459414-74459436 CCTGGGAGGCTGAGGCAGGAAGG - Intronic
1129312904 15:74725039-74725061 CCTTGGGTGGACAGGGTGGATGG - Intronic
1129325682 15:74799093-74799115 GGCTGGGGGCAGAGGCAGGAGGG + Intronic
1129607919 15:77033777-77033799 CCTGGGAGGCAGAGGCTCGTGGG + Intronic
1129832938 15:78682400-78682422 GCGTGGGGGCAGTGGCAGGAAGG + Intronic
1130001471 15:80050971-80050993 CCTGGGAGGCTGAGGTTGGAGGG + Intergenic
1130088966 15:80803219-80803241 CCTTGGGGCCACAGGATGGCTGG + Intronic
1130109936 15:80955694-80955716 CCTGGGGGGCGGAGGTTGCAGGG - Intronic
1130165687 15:81455623-81455645 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1130222653 15:82033651-82033673 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1130348640 15:83070906-83070928 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1130892076 15:88141850-88141872 CCCTGGGGGGAAAGGATGGAAGG - Intronic
1130936525 15:88475563-88475585 CTTGGGAGGCTGAGGCTGGATGG + Intronic
1130990149 15:88871262-88871284 CCTTGAGGGCACAGCATGGAAGG + Intronic
1131040922 15:89266102-89266124 CTTGGGAAGCAGAGGCTGGAGGG - Intronic
1131219419 15:90569393-90569415 CCAGGGAGGCAGAGGCTGCAGGG - Intronic
1131314154 15:91318038-91318060 CTGTGGAAGCAGAGGCTGGAGGG - Intergenic
1131383810 15:91986107-91986129 CCTGGTGGGCAGAGGCTGAGTGG + Intronic
1131693015 15:94846474-94846496 CTTTGGGGACAGAGGATGCACGG + Intergenic
1131892336 15:96985470-96985492 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1131963204 15:97810323-97810345 CTTGGGGGGCTGAGGCGGGAGGG + Intergenic
1132019903 15:98351834-98351856 CATTGGGGGCAGATGCAGCAAGG + Intergenic
1132040754 15:98523053-98523075 CCTGGGGGGCTGAGGAGGGAGGG - Intergenic
1132259274 15:100407945-100407967 CCTTGGAGGCAGAGGTTGCAGGG - Intronic
1132288645 15:100684145-100684167 CCTTGAGGGTGGAGGCTGGGAGG - Intergenic
1132547168 16:538655-538677 CCTTGGGGACAGAAGCTTCAAGG - Intronic
1132598662 16:764398-764420 CCCTTGGGGCAGAGCCTGGAGGG - Intronic
1132652906 16:1029497-1029519 GCCTGGGTGCACAGGCTGGAGGG - Intergenic
1132712259 16:1274283-1274305 CCTGGGAGGCGGAGGCTGCAGGG - Intergenic
1132854339 16:2038127-2038149 CCTGGTGGGCAGGGGCAGGATGG - Exonic
1132861896 16:2075959-2075981 CCTTGGGGACAAAGGCTGCCGGG - Intronic
1133028399 16:2998439-2998461 CACTGGGGGCAGAGGCTAGAAGG - Intergenic
1133081540 16:3325055-3325077 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1133235678 16:4386366-4386388 CACTGGGGGCAGAGCCTGGAAGG + Intronic
1133434409 16:5766788-5766810 CCTTGAGGGCAGAAGCAGGGTGG - Intergenic
1133566744 16:7002634-7002656 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1133792755 16:9021952-9021974 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1133824288 16:9263156-9263178 CTTTGGAGGCAGACGCAGGAGGG - Intergenic
1133841979 16:9418239-9418261 GCTTGGGAGAAGAGCCTGGAGGG - Intergenic
1133856686 16:9556306-9556328 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1133976683 16:10604109-10604131 CGATGGAGGCAGAGGTTGGAGGG + Intergenic
1134072366 16:11268784-11268806 CCTTGGGGGCAGTGAGAGGAAGG - Intronic
1134338152 16:13320213-13320235 CCCAGGAGGCAGAGGCTGCACGG + Intergenic
1134688787 16:16177384-16177406 CCTTGGGGGAAAAGGCTCGAAGG - Intronic
1134752815 16:16639721-16639743 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1134993243 16:18719355-18719377 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1135032891 16:19052786-19052808 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1135035468 16:19073231-19073253 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1135246935 16:20864978-20865000 ACTTGAGGGTAGAGGGTGGAGGG + Intronic
1135289089 16:21219196-21219218 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1135608005 16:23839515-23839537 ACTTGGGGGCTGAGGTGGGAGGG - Intronic
1135674881 16:24406856-24406878 CCTTGTGGGCAGAAACTGGAGGG - Intergenic
1135975697 16:27107929-27107951 CCTGGGGGGCCCAGGCAGGAGGG + Intergenic
1135989883 16:27211752-27211774 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1136022638 16:27449753-27449775 TCCTGGAGGCAGACGCTGGAGGG - Exonic
1136276131 16:29180452-29180474 CCATGGGGGCTGAGACTGGGGGG - Intergenic
1136314695 16:29446208-29446230 CCTGGGGGGCTGAGGTGGGAGGG + Intronic
1136376391 16:29867980-29868002 CCTTGCTGGCTGAGGCTGGAGGG - Intergenic
1136409078 16:30065975-30065997 TCTTGGGGGCAGTGGCGGGTTGG + Intronic
1136442822 16:30287967-30287989 CCTGGGGGGCTGAGGTGGGAGGG + Intergenic
1137024942 16:35464398-35464420 CCTTGGGGGCACAGGTGGGGTGG + Intergenic
1137542713 16:49376212-49376234 TGTTGGGGGAAGAGCCTGGATGG - Intronic
1137555828 16:49469763-49469785 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1137931048 16:52588111-52588133 CTTTTGGGGAAGAGGCTGAAGGG - Intergenic
1137974970 16:53023509-53023531 CCATGGGAGGACAGGCTGGAGGG + Intergenic
1138750920 16:59420194-59420216 ACTTGGGAGGGGAGGCTGGAAGG - Intergenic
1139190000 16:64851799-64851821 CCTAGGATGCAGTGGCTGGAAGG - Intergenic
1139765773 16:69228428-69228450 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1140134186 16:72190629-72190651 GCTTGGGGTCAGAGGCAGGCGGG + Intergenic
1140203607 16:72914746-72914768 CTTTGGGGGCTGAGGCAGGCAGG + Intronic
1140755238 16:78060637-78060659 CCTGGGAGGCAGAGGTTGTATGG - Intronic
1141069603 16:80941885-80941907 CCTAGGAGGCAGAGGTTGCAGGG - Intergenic
1141337063 16:83165926-83165948 CAGTGGTGGGAGAGGCTGGAGGG + Intronic
1141507289 16:84486267-84486289 CGGTGGGGGCAGGGGCAGGAAGG + Intronic
1141671708 16:85495570-85495592 CCCTGGAGGTAGAGGCTGCAGGG - Intergenic
1141675632 16:85515841-85515863 CCTTGGCAGAAGAGGCAGGAGGG - Intergenic
1141697342 16:85626339-85626361 CCCTGGCGGCTGAGGCTGCACGG - Intronic
1141748573 16:85942878-85942900 CCCAGGGGGCAGAGGTTGCAGGG - Intergenic
1141842651 16:86584049-86584071 CTGAGGGGGCAGAGGCAGGATGG - Intergenic
1142020777 16:87780876-87780898 ACTTGTGGGCAGAGGGAGGAAGG - Intergenic
1142133913 16:88443021-88443043 CCTCGGGGGCTGACGTTGGAGGG + Intergenic
1142286342 16:89173062-89173084 CCTCAGGGGCAGCTGCTGGAGGG - Intronic
1142332980 16:89467468-89467490 CTTGGGAGGCTGAGGCTGGATGG - Intronic
1142345172 16:89549414-89549436 CTTTGGGGGCTGAGGCAGGAGGG + Intronic
1142431200 16:90028719-90028741 CCATGAGGGCAGAGGCCAGAGGG - Intronic
1142571531 17:878038-878060 CCCTGGGGGCACAGTCTGGAGGG + Intronic
1143091763 17:4453063-4453085 TCTTGGGGGCAGAAGCTGCGAGG + Exonic
1143124669 17:4634026-4634048 ACTTGTGGACAGAGGGTGGAAGG + Intronic
1143215191 17:5219550-5219572 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1143297064 17:5879161-5879183 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1143419665 17:6778936-6778958 CCTGGGGGACAGAGGAAGGATGG - Intronic
1143775357 17:9195518-9195540 CCTTGCTGGCAGAGGCTGGCAGG + Intronic
1143899062 17:10159859-10159881 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1144613999 17:16751888-16751910 CCCTGGGGGCAGACACTGGAGGG - Intronic
1144676889 17:17167726-17167748 AGTTGGGGGCAGGGGCTGGCAGG - Intronic
1144898713 17:18563783-18563805 CCCTGGGGGCAGACACTGGAGGG + Intergenic
1144950680 17:18991964-18991986 CCTGGGGGGCAGAGGCAGGCAGG + Intronic
1145133662 17:20381940-20381962 CCCTGGGGGCAGACACTGGAGGG - Intergenic
1146275515 17:31513427-31513449 CCTGGAGGGGAGATGCTGGAAGG - Intronic
1146323279 17:31863808-31863830 CCCTGGAGGCTGAGGCAGGAGGG - Intronic
1146323900 17:31869033-31869055 CCTGGGAGGCGGAGGCTGCAGGG + Intronic
1146379676 17:32319530-32319552 CCTGGGGAGCCAAGGCTGGAAGG + Intronic
1146381891 17:32336644-32336666 CTTTGGTGCCAGAGGCTGCATGG + Intronic
1146492122 17:33291146-33291168 CTTTGGGGGCTGACACTGGAAGG + Intronic
1146652433 17:34614906-34614928 CCATGGGAGCAGAGTCTAGAGGG + Intronic
1146848532 17:36201630-36201652 CCTCGGGGCCAGAATCTGGAAGG - Intronic
1147177384 17:38664266-38664288 CCCTGGGGGTAGAGGCAGGGGGG - Intergenic
1147192547 17:38746551-38746573 TCTGGGGACCAGAGGCTGGAGGG + Intronic
1147218648 17:38915302-38915324 CGTAGTGGGCAGAGGCTGGCTGG + Intronic
1147449628 17:40496060-40496082 CCCTGGGGGAAGCAGCTGGAAGG + Exonic
1147638297 17:41977538-41977560 CCTTTGGGGCAGCAGTTGGAAGG - Exonic
1147670644 17:42174976-42174998 CTTGTTGGGCAGAGGCTGGAGGG - Intronic
1147681421 17:42249734-42249756 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1148074442 17:44927412-44927434 CCTGTGGGGCAGAGGCTGGCAGG - Intronic
1148435591 17:47681938-47681960 CCTGGGAGGCTGAGGCAGGAGGG - Intronic
1148486814 17:47996123-47996145 CCTTGGGAGCAGATGGTGGGAGG - Intergenic
1148542773 17:48493306-48493328 TCTTGGGGGCTCAGGGTGGAAGG + Intergenic
1148753224 17:49957949-49957971 CCCGGGAGGCAGAGGCTGCAGGG + Intergenic
1148830116 17:50425852-50425874 CCGAGGGGGCAGGGGATGGATGG + Intergenic
1148892755 17:50819905-50819927 CCTTGGGGAAGGAAGCTGGAAGG + Intergenic
1148917607 17:50995769-50995791 CCTTGGAGGCTGAGGTGGGAGGG - Intronic
1149494276 17:57107125-57107147 ACTTGGGGGCTGAGGATGGATGG + Exonic
1149702850 17:58669656-58669678 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1149801438 17:59571664-59571686 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1149911980 17:60575057-60575079 CCTTGGAGGTGGAGACTGGAGGG + Intronic
1149955292 17:61042780-61042802 CCTGGGAGGCTGAGGCAGGAGGG + Intronic
1150157273 17:62864676-62864698 CCTTGGGGCCAGATGCTGCTTGG + Intergenic
1150356076 17:64485990-64486012 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1150651996 17:67016407-67016429 CCTTGGAGGCAGCAGCTGAAGGG + Intronic
1150704798 17:67477181-67477203 CTTGGGGGGCTGAGGCAGGAGGG - Intronic
1151158159 17:72142009-72142031 CCTGGGGGACTGAGGCAGGAGGG - Intergenic
1151328680 17:73394145-73394167 CCTTGGATGGAGAGGCTGGAGGG + Intronic
1151412235 17:73938695-73938717 CCTTGGAGGTGGATGCTGGAAGG + Intergenic
1151517801 17:74607626-74607648 CATGGAGGGCAGAGGGTGGAGGG + Intergenic
1151707024 17:75774510-75774532 CCTTGGAGGAGGATGCTGGAAGG + Intergenic
1151738969 17:75966052-75966074 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1151767030 17:76137937-76137959 CCTGGCGGGCAAAGGCTGGGTGG + Exonic
1151880280 17:76890577-76890599 CCTGAGAGGCAGAGGCTGCAGGG - Intronic
1151930383 17:77228282-77228304 CAGTGTGGGAAGAGGCTGGACGG + Intergenic
1151968770 17:77446295-77446317 GGATGGAGGCAGAGGCTGGAGGG - Intronic
1152054413 17:78012336-78012358 CCTTGAGGGTGGAGGGTGGAAGG + Intronic
1152101790 17:78305755-78305777 CAGTGGGGACAGAGGCTGCAGGG - Intergenic
1152117969 17:78400307-78400329 CCTGGGAGGCGGAGGCTGCAGGG + Intronic
1152257520 17:79248778-79248800 CTTTGGGGACTGAGGCTGGCAGG + Intronic
1152379448 17:79934825-79934847 GCCTGGGGGCGGGGGCTGGAGGG - Exonic
1152395716 17:80031605-80031627 CCTTGGAGGCAGAGGCTTTGGGG - Intronic
1152542757 17:80984690-80984712 CCCTGGAGGCAGAGGTTGCAGGG + Intergenic
1152778451 17:82216035-82216057 CCAAGGGTGCCGAGGCTGGAAGG - Intergenic
1153190520 18:2532755-2532777 ACAGAGGGGCAGAGGCTGGAAGG + Intergenic
1153767175 18:8385662-8385684 GCTTGGGGGCCCCGGCTGGAAGG + Intronic
1153842461 18:9019119-9019141 ACTTGAAGGCAGAGGGTGGAAGG - Intergenic
1154407671 18:14109029-14109051 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1155107782 18:22684709-22684731 CCGTGGAGGCAGAGGTTGCAGGG + Intergenic
1156356456 18:36346256-36346278 CTTGGGGGGCTGAGGCAGGAGGG + Intronic
1156485016 18:37459654-37459676 CCTTGGCCTCAGAGTCTGGAGGG + Intronic
1156894384 18:42229003-42229025 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1157188778 18:45562792-45562814 CCTGGGGGGAAGGGGCTGGGTGG + Intronic
1157232223 18:45928118-45928140 CCTGGGAGGCAGAGGTTGTAGGG + Intronic
1157387650 18:47271963-47271985 CCCTGGAGGCAGAGGTTGCAGGG - Intergenic
1157517353 18:48320454-48320476 AACTGGGGGCAGAGGCTGGGAGG + Intronic
1157872267 18:51241429-51241451 GCCTGGGGCCAGATGCTGGAGGG + Intergenic
1158527872 18:58231636-58231658 CCTTGGAGGCGGAGGTTGCAGGG - Intronic
1158708344 18:59814867-59814889 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1158843981 18:61420973-61420995 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1159053164 18:63440547-63440569 CCTTGGGGTCTGAGGTTGGGTGG + Intergenic
1159209826 18:65304142-65304164 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1159841691 18:73405880-73405902 CCCAGGAGGCAGAGGCTGCAGGG - Intergenic
1160193002 18:76730555-76730577 CCCAGGGGGCAGAGCCTGCAGGG + Intergenic
1160507948 18:79437685-79437707 CCGTCAGGGCAGAGGGTGGAGGG - Intronic
1160571785 18:79822513-79822535 CCCTGGAGGCTGAGGCTGCAGGG - Intergenic
1160723649 19:608297-608319 TCCTGGGGTCTGAGGCTGGAGGG + Intronic
1161105495 19:2441764-2441786 CCCTGGGGGCAGAGACCTGAAGG + Intronic
1161147111 19:2685547-2685569 CCCAGGAGGCAGAGGCTGCAGGG + Intronic
1161175846 19:2841777-2841799 CCTTGGGGCCAGAGGCGGGCGGG - Intronic
1161564898 19:4996448-4996470 CCCAGGGGGCTGAGGCTGCAAGG - Intronic
1161570510 19:5028217-5028239 TCTGGGGGGCTGAGGCGGGAGGG - Intronic
1161621746 19:5301389-5301411 CCTGGGAGGCAGAGGGTGCAGGG - Intronic
1161628485 19:5339936-5339958 CCCTGGGTGGGGAGGCTGGAAGG + Intronic
1161768318 19:6218644-6218666 CCCTGGTGGCTGAGCCTGGAAGG - Intronic
1161840224 19:6675615-6675637 TCTTGGAGCCAGAGGCTGTATGG - Intergenic
1161981891 19:7634187-7634209 CCCTGGGGACAGAGGCAGGCGGG + Intronic
1162000055 19:7738547-7738569 CCCAGGAGGCAGAGGCTGCAGGG + Intergenic
1162088952 19:8265406-8265428 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1162374105 19:10294979-10295001 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1162522483 19:11190002-11190024 ACTGGAGGGCACAGGCTGGAGGG - Intronic
1162654889 19:12121174-12121196 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1162786121 19:13036096-13036118 CCAAGGGGGCTGCGGCTGGAGGG + Intronic
1162796875 19:13091678-13091700 CCCTGCTGGCAGAGGCGGGAGGG + Intronic
1163024052 19:14499397-14499419 ACTTGGAGGCTGAGGCTGAAAGG + Intergenic
1163303593 19:16463223-16463245 CCTGGTGGGCAGAGCCTGGTGGG - Intronic
1163562004 19:18024928-18024950 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1163818829 19:19484606-19484628 CCCGGGGGGCAGAGCCTGCAGGG - Intronic
1163849876 19:19656766-19656788 CCTGCAGGGCAGAGGCAGGAGGG + Exonic
1164208964 19:23081176-23081198 ACTTTGTTGCAGAGGCTGGAGGG + Intronic
1164633018 19:29774051-29774073 CCTGTGGGGCAGGGGCTGGCTGG - Intergenic
1165232407 19:34395284-34395306 CTTGGGAGGCAGAGGCTGGGGGG + Intronic
1165348986 19:35266586-35266608 ACTGAGGGGCAGGGGCTGGAAGG + Intronic
1165504552 19:36217136-36217158 CCTGGGGGGCAGAGGTTGCAGGG - Intronic
1165585432 19:36911285-36911307 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1165616326 19:37204820-37204842 CCTAGGAGGCAGAGGTTGCAGGG - Intronic
1166126934 19:40720577-40720599 CCATGGAGGCAGATTCTGGAAGG - Intronic
1166310230 19:41958591-41958613 CCTTGGGGGCGGGGCCTGGGCGG + Intronic
1166354420 19:42218435-42218457 CCTGGAGGGCAGAGATTGGAAGG - Intronic
1166356464 19:42230313-42230335 CCTTGGGGGCAGAGGACAGGAGG + Exonic
1166557582 19:43711133-43711155 CCTCGGAGGCGGAGGCTGCAGGG + Intergenic
1166690969 19:44821045-44821067 CCTTGCCGGCAGAGGAAGGAAGG - Exonic
1166837037 19:45673786-45673808 CCCTGGGGGGCGAGGCTGCAGGG + Intronic
1166859022 19:45798927-45798949 GGGTGGGGGCAGAGGATGGATGG + Intronic
1166887279 19:45969781-45969803 ACTTGGGTGAAGAGGTTGGACGG - Intronic
1166949639 19:46417988-46418010 CTTTTTGGGGAGAGGCTGGAAGG - Intergenic
1167151000 19:47709602-47709624 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1167172773 19:47844313-47844335 CCCAAGAGGCAGAGGCTGGAGGG - Intergenic
1167303269 19:48692148-48692170 CCTGGGAGGCAGAGGCGGGGTGG - Intergenic
1167903724 19:52641067-52641089 TCTTGGGGGCGGGGTCTGGAGGG - Intronic
1167922862 19:52796540-52796562 CCTGGGAGGTAGAGGCTGCAGGG - Intronic
1168052642 19:53840880-53840902 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1168153607 19:54461589-54461611 CACTGGGGGCAGAGGGAGGAGGG - Exonic
1168168782 19:54573057-54573079 CCTGGGAGGCGGAGGCTGCAGGG - Intronic
1168277424 19:55285348-55285370 CCATAGGGGCAGAGGCTGGAGGG + Intronic
1168280349 19:55302334-55302356 TCTAGGGGTCAGAGGCAGGAGGG + Intronic
924960931 2:33849-33871 CCGTGCAGGCAGAGGCAGGAAGG - Intergenic
925063374 2:910517-910539 CCTGGGGTGCAGAGGCTGTTGGG - Intergenic
925165386 2:1712798-1712820 CCTTGGAGGCGGAGGTTGCAGGG - Intronic
925565725 2:5252183-5252205 ACTTGAGGGCGGAGGGTGGAAGG - Intergenic
925752510 2:7102254-7102276 CCTGGGAGGCAGAGGTTGTAGGG - Intergenic
925864768 2:8217818-8217840 AAGTGGGGGCAGGGGCTGGAGGG - Intergenic
925915772 2:8604765-8604787 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
925990421 2:9250147-9250169 CCTTGGGGGCAGAAACTGCCAGG + Intronic
926309642 2:11666228-11666250 CCTCTGGGGCAGCAGCTGGAAGG - Intronic
926315110 2:11703987-11704009 CCTTGGTGGGGGTGGCTGGAAGG + Intronic
926531306 2:14049665-14049687 CCTTGAGGGCAGAGGGTGGGAGG - Intergenic
926615185 2:14990346-14990368 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
927104694 2:19813034-19813056 CCTTGTGGCCAGAGGCCTGATGG - Intergenic
927165618 2:20317701-20317723 CCTTGAGGGTAGAGGGTGGGAGG - Intronic
927194294 2:20537211-20537233 CCTGGGGTGCAGGGTCTGGATGG - Intergenic
927205729 2:20609168-20609190 CCTTGGGGGCAGAGGCCGCCAGG + Intronic
927756025 2:25708533-25708555 CCTTGGGGGAAGAGGGTAGTAGG + Intergenic
928936382 2:36683116-36683138 AGTTGGGGGCATGGGCTGGAAGG + Intergenic
928944419 2:36760068-36760090 CCTGGGAGGCAGAGGTTGTAGGG - Intronic
929149849 2:38737766-38737788 CTTAGGAGGCTGAGGCTGGAGGG - Intronic
929181775 2:39048474-39048496 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
929499659 2:42479536-42479558 CTTGGGGGGCTGAGGCAGGAGGG + Intronic
929593678 2:43162506-43162528 CCTTGGGGGCAGTGGCCAGAGGG + Intergenic
929679146 2:43971022-43971044 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
930284294 2:49408924-49408946 CCTTGGAAGCAGAGCCTGGGAGG - Intergenic
930426762 2:51222664-51222686 CCCAGGAGGCAGAGGCTGCAGGG - Intergenic
931209524 2:60179309-60179331 TCTTGTGGGCAGTGGCTGCATGG - Intergenic
931216545 2:60250146-60250168 CCTGGGAGGCAGAGGCTTCAGGG + Intergenic
931352350 2:61503039-61503061 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
931728980 2:65136358-65136380 CCTGGGAGGCTGAGGCAGGAGGG + Intergenic
932150927 2:69371150-69371172 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
932181675 2:69652086-69652108 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
932188242 2:69716958-69716980 GCCAGGGAGCAGAGGCTGGACGG - Intronic
932429771 2:71667364-71667386 TCTCTGGGGCAGAGGCTGGCAGG + Exonic
932553831 2:72799987-72800009 CCCTGGAGGCAGAGGCTGCAGGG + Intronic
932573637 2:72951074-72951096 CCTGGAGGGCAGGGGCTGCAGGG + Intronic
933508875 2:83214563-83214585 CCTGGGGGGCAGAGGTTGCAGGG - Intergenic
933593074 2:84254531-84254553 CCTTGAGGGTAGAGGGTGGGAGG - Intergenic
933689576 2:85169267-85169289 GCTAGGGGGTAGAGTCTGGAAGG - Intronic
933695553 2:85214581-85214603 CCTTGGGGGCAGAGGAATGTTGG + Intronic
933818034 2:86084339-86084361 CCTGAGAGGCAGAGGCTGTAGGG + Intronic
934053530 2:88231711-88231733 CAGTGGAGGCAGAGGCTGGTGGG + Intergenic
934070720 2:88381632-88381654 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
934159193 2:89232056-89232078 CCGTGGGGGCAGAGACTGTGAGG + Intergenic
934208079 2:89950369-89950391 CCGTGGGGGCAGAGACTGTGAGG - Intergenic
934583959 2:95472600-95472622 CCTGGGTGGCAGAGGTTGCAAGG - Intergenic
934595493 2:95604114-95604136 CCTGGGTGGCAGAGGTTGCAAGG + Intergenic
934787281 2:97021369-97021391 CCTGGGTGGCAGAGGTTGCAAGG - Intergenic
935035648 2:99369898-99369920 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
935134887 2:100291425-100291447 CCTTGTGGGCGAAGGCAGGAGGG - Intronic
935293183 2:101626948-101626970 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
935443517 2:103131661-103131683 CCTAGGAGGTGGAGGCTGGAGGG + Intergenic
935730575 2:106062015-106062037 CCTTGGAGGCAGAGTCAAGATGG + Intergenic
936522025 2:113217546-113217568 CCTTGGGGGCAGGAGCTGCTGGG + Exonic
937122707 2:119451927-119451949 CCACAGGGGCAGAGGGTGGAAGG - Intronic
937227376 2:120377559-120377581 CCATGGGGTCAGAGGCTGCTGGG - Intergenic
937263455 2:120601123-120601145 CCTTGGGGTCAGAGGCTGATTGG - Intergenic
937757008 2:125551867-125551889 GGAAGGGGGCAGAGGCTGGAAGG + Intergenic
937782962 2:125860335-125860357 ACTTGGGGGCAGAGAGTGGGAGG - Intergenic
938213004 2:129484386-129484408 CCTGAGGAGCAGGGGCTGGATGG - Intergenic
938364824 2:130726678-130726700 CCTTGGGTGCAGACGCGGGGTGG - Intergenic
938541978 2:132290661-132290683 CCCGGGAGGCAGAGGTTGGAGGG + Intergenic
939308351 2:140438122-140438144 CTCTGGAGGCTGAGGCTGGAGGG - Intronic
940864194 2:158800913-158800935 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
941651962 2:168101660-168101682 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
941670759 2:168289743-168289765 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
942133355 2:172902176-172902198 GAGTGGGGGCTGAGGCTGGAGGG + Intronic
942449189 2:176098646-176098668 TCTTGGGATCAGAGGCAGGAGGG + Intergenic
942461383 2:176171113-176171135 CCCTGGCAGCAGAGGCTGGGAGG + Intronic
942541275 2:177017771-177017793 CCCTGGGGACAGAGGGTGGGAGG + Intergenic
943600422 2:189912463-189912485 CCTGAGAGGCAGAGGCTGCAGGG + Intronic
944125074 2:196283449-196283471 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
944743285 2:202633277-202633299 CCCGGGAGGCAGAGGTTGGAAGG - Intergenic
945068407 2:205966722-205966744 TCTGGAGGGGAGAGGCTGGAGGG + Intergenic
945072953 2:206009230-206009252 CCCTGGAGGCAGAGGTTGCAGGG + Intronic
945234590 2:207622981-207623003 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
945261080 2:207843973-207843995 CCTGGGAGGCTGAGGCTGGAGGG + Intronic
945594341 2:211773178-211773200 CCTTGGTAGCAGAGGCTGGGAGG + Intronic
945723260 2:213445552-213445574 CTTTGGAGGCTGAGGCAGGAGGG + Intronic
946090013 2:217213507-217213529 CCTTGAGGACGGAGGGTGGAAGG + Intergenic
946242777 2:218367237-218367259 GCTTGGGGTCAGGGGCTGGAGGG - Intronic
946699045 2:222392729-222392751 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
947487770 2:230568118-230568140 CCCTGGAGGCAGAGGTTGCAGGG + Intergenic
947504359 2:230695531-230695553 CCTGTGAGGCAGAGGCTGCAGGG + Intergenic
947686826 2:232094641-232094663 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
948064006 2:235063078-235063100 CCCAGGAGGCAGAGGCTGCAGGG + Intergenic
948143314 2:235690347-235690369 CCCTGGGGGCAGGTGCAGGAGGG + Intronic
948298702 2:236885616-236885638 CCATGGGTGAAGAGGGTGGATGG - Intergenic
948353283 2:237358143-237358165 CCTTGGCCACAGAGGCAGGATGG + Intronic
948464032 2:238143657-238143679 CCTTGGCGTCAGCGGCTGGCAGG + Intronic
948470278 2:238173113-238173135 CTTTGGGGGCAGATCCTGAAGGG - Intronic
948548001 2:238746210-238746232 AGTGGGGGGCACAGGCTGGAGGG - Intergenic
948861784 2:240756113-240756135 CCTTGGGTGGAGATGGTGGAAGG - Intronic
948917037 2:241039636-241039658 CCCTGGGGCGAGAGGCTGGGTGG - Intronic
1168794862 20:604629-604651 CCTGGGGGGCAGCTGCTTGAAGG - Exonic
1169114699 20:3056576-3056598 ACTTGGGGGCTGAGGCAGGGAGG - Intergenic
1169215000 20:3788059-3788081 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1170732796 20:18988943-18988965 ACCTGGAGGCAGAGGCGGGAGGG + Intergenic
1171117308 20:22536200-22536222 GGCTGGTGGCAGAGGCTGGAGGG - Intergenic
1171321583 20:24248980-24249002 CCTTGGTGGGGCAGGCTGGAAGG - Intergenic
1171984184 20:31648062-31648084 CCTAGGGGGCAGAGGTTGCAGGG - Intergenic
1172117498 20:32581560-32581582 CCCTGGGGACAGAGGCTATATGG + Intronic
1172427539 20:34865258-34865280 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1172555923 20:35841235-35841257 CTTGGGAGGCTGAGGCTGGAGGG + Intronic
1172575616 20:36006102-36006124 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1172579672 20:36036950-36036972 CCTTGGGGACAGACACTGGAGGG + Intergenic
1172707472 20:36892546-36892568 CTTGGGGGGCTGAGGCAGGAGGG + Exonic
1172753458 20:37267492-37267514 ACTTGGAGGCAGAGGCAGGCAGG + Intergenic
1172769638 20:37373551-37373573 CTTTGGGGGCCAAGGCAGGAGGG - Intronic
1172833214 20:37854662-37854684 CCTTGGAGGCAGAAGTTGCAGGG - Intronic
1173649739 20:44655583-44655605 ACTAAGGTGCAGAGGCTGGAGGG - Intergenic
1173697564 20:45032418-45032440 CCTTGAGGGCAGAGGGTGGGAGG - Intronic
1173797916 20:45875575-45875597 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1173869163 20:46330885-46330907 GCCTGTGGCCAGAGGCTGGAAGG + Intergenic
1173961488 20:47075849-47075871 ACTTGAGGGTAGAGGATGGAAGG - Intronic
1174120244 20:48259636-48259658 CCTTTGGGGCAGAGACTGGGAGG - Intergenic
1174343440 20:49912527-49912549 CCCTGGGGCCAGAGGCGTGATGG - Intronic
1175028607 20:55929859-55929881 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1175400276 20:58696286-58696308 GAATGTGGGCAGAGGCTGGATGG - Intronic
1175451461 20:59072344-59072366 CAATGGAGGCAGAGGCTGGAGGG + Intergenic
1175786765 20:61716830-61716852 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1175885541 20:62288384-62288406 CTGTGGGTGCAGAGGCTGGGAGG + Intronic
1175885547 20:62288407-62288429 CTGTGGGTGCAGAGGCTGGGAGG + Intronic
1175885553 20:62288430-62288452 CTATGGGTGCAGAGGCTGGGAGG + Intronic
1175885565 20:62288475-62288497 CTGTGGGTGCAGAGGCTGGGAGG + Intronic
1175885577 20:62288520-62288542 CTGTGGGTGCAGAGGCTGGGAGG + Intronic
1175885589 20:62288565-62288587 CTGTGGGTGCAGAGGCTGGGAGG + Intronic
1175943816 20:62549772-62549794 CCTTGGTGGCAGGGCCTGGCTGG + Intergenic
1176131645 20:63498966-63498988 CCTGGGGGGCAGAGGGTGGCCGG - Intronic
1176239261 20:64068403-64068425 CCTTGGGGGAAGAGGCCAGGGGG - Intronic
1176427288 21:6556529-6556551 CATTGGGGCCAGAGGCTCGCAGG + Intergenic
1177003567 21:15643165-15643187 CCATGGAGGCAGAGGTCGGAGGG - Intergenic
1177009847 21:15718719-15718741 ACTTGAGGGTGGAGGCTGGAAGG + Intergenic
1177454323 21:21316617-21316639 CCTGGGAGGCAGAGGTTGTAGGG - Intronic
1177493947 21:21864311-21864333 AGTTGAGGGCAGAAGCTGGAAGG + Intergenic
1177705183 21:24695159-24695181 CCTAGGAGGCAGAGGTTGCAGGG - Intergenic
1177844993 21:26279005-26279027 CAGTGAGGGCAGATGCTGGAGGG - Intergenic
1178335544 21:31739436-31739458 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1179499403 21:41797734-41797756 CCTGGGAGGCGGAGGCTGCAGGG + Intergenic
1179615914 21:42583504-42583526 CCTTGTGGGCACAGCCTGCAAGG - Intergenic
1179702779 21:43164846-43164868 CATTGGGGCCAGAGGCTCGCAGG + Intergenic
1179725520 21:43339503-43339525 CCTTGTAGGCAGAGGCTGAGGGG - Intergenic
1179774600 21:43653057-43653079 CCCAGGGGGCAGAGGTTGCAGGG + Intronic
1179884057 21:44305976-44305998 CCTGGGTGGCTGAGGCCGGAGGG + Intronic
1179993120 21:44958831-44958853 CCCTGGGGCCAGAGCCGGGAAGG + Intronic
1180199502 21:46215919-46215941 CCTCGGGGTCAGTTGCTGGAGGG - Intronic
1180787071 22:18553269-18553291 CCGTGGGGGCCCAGGCTGGCAGG - Intergenic
1180797705 22:18614871-18614893 ACTTTGGGGCAGCTGCTGGATGG - Intergenic
1180994135 22:19956450-19956472 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1181083401 22:20428378-20428400 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1181098263 22:20521170-20521192 CCTAGGAGGCAGAGGTTGCAGGG - Intronic
1181129828 22:20724530-20724552 TCTGGGAGGCAGAGGCTGCAAGG + Intronic
1181224012 22:21380389-21380411 ACTTTGGGGCAGCTGCTGGATGG + Intergenic
1181234669 22:21442037-21442059 CCGTGGGGGCCCAGGCTGGCAGG + Intronic
1181243980 22:21492794-21492816 CCGTGGGGGCCCAGGCTGGCAGG - Intergenic
1181254621 22:21554428-21554450 ACTTTGGGGCAGCTGCTGGATGG - Intronic
1181265010 22:21625854-21625876 CCTGGGAGGTAGAGGCTGCAGGG - Intergenic
1181280926 22:21719934-21719956 CCTGGGGGGCGGAGGTTGCAGGG + Intronic
1181302779 22:21893248-21893270 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1181371683 22:22424083-22424105 CCTAGGAGGCTGAGGCAGGAGGG + Intergenic
1181464275 22:23102390-23102412 CCCTGGGAGCAGAGGAAGGAAGG - Intronic
1181492026 22:23266463-23266485 CCTGGGAGGCAGAGGTTGCAAGG - Intronic
1181600845 22:23951131-23951153 CCTAGAGGCTAGAGGCTGGAGGG + Intergenic
1181607668 22:23990195-23990217 CCTAGAGGCTAGAGGCTGGAGGG - Intergenic
1181817394 22:25448660-25448682 CCCTGGGGGCGGGGGTTGGAGGG - Intergenic
1181904692 22:26185006-26185028 CCCAGGTGGCAGAGGCTGCAGGG + Intronic
1182361556 22:29749459-29749481 CCTTGGGTGCAAAGGCCGGGAGG - Intronic
1182975946 22:34624214-34624236 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1183271938 22:36867769-36867791 CCTTGGGGGCAGACACTGGATGG - Intronic
1183358495 22:37371697-37371719 CCATGGTGACAGAGGCTGGCTGG + Exonic
1183385071 22:37509818-37509840 GCTTGTGGGCACAGGCTGGCAGG - Intronic
1183385114 22:37509937-37509959 GCTTGTGGGCACAGGCTGGCAGG - Intronic
1183385192 22:37510175-37510197 GCTTGTGGGCACAGGCTGGGGGG - Intronic
1183386076 22:37515485-37515507 CCCGGGAGGCAGAGGCTGCAAGG + Intronic
1183724436 22:39580642-39580664 CATGTGGGGCAGGGGCTGGATGG + Intronic
1183906910 22:41048534-41048556 CCTGGGAGGCGGAGGCTGCATGG + Intergenic
1183995008 22:41626528-41626550 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1184037732 22:41926503-41926525 CCCTGTGGGCAGGGCCTGGAGGG - Intronic
1184146921 22:42617197-42617219 CCTGGGAGGCAGAGGCTGCAGGG + Intergenic
1184232997 22:43168591-43168613 CCTGCGGTGCAGAGTCTGGAGGG - Intronic
1184250919 22:43259873-43259895 CCTGAGGAGAAGAGGCTGGAGGG - Intronic
1184304193 22:43584321-43584343 CTTTGGAGGCACAGGCTGGCAGG + Intronic
1184334680 22:43846141-43846163 GGTTGGGCTCAGAGGCTGGAGGG - Intronic
1184533582 22:45071728-45071750 CCATCGGCTCAGAGGCTGGAGGG - Intergenic
1184624380 22:45712176-45712198 CCCTGGGGGCACAGGCTGTCAGG + Intronic
1184701415 22:46176061-46176083 CCTAGGAGGCAGAGGTTGCAAGG + Intronic
1184904685 22:47473010-47473032 CCTTGGGGGAAGAAACTGGGAGG - Intronic
1184946671 22:47808736-47808758 CCTTGCGGGCAGAGGCTGCACGG + Intergenic
1185285344 22:49997449-49997471 CTTTGTGGGCGAAGGCTGGATGG + Intronic
1185379520 22:50501928-50501950 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
949211739 3:1511380-1511402 CGTGGGAGGCAGAGGCTGGATGG - Intergenic
949494895 3:4622188-4622210 CCCAGGAGGCAGAGGCTGCAGGG - Intronic
949624973 3:5855150-5855172 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
949931487 3:9082033-9082055 CATTGGAGGCAGAGCCTGGCAGG + Intronic
949990049 3:9571291-9571313 CCCGGGAGGCAGAGGCTGCAGGG - Intergenic
950496002 3:13334994-13335016 CCTGCGGGGCAGGGGCTGCAGGG - Intronic
950604373 3:14065045-14065067 CTTTGGGTGCAGAGCCAGGAGGG + Exonic
951000710 3:17556088-17556110 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
951000943 3:17559214-17559236 CCTAGGAGGCAGAGGTTGCAGGG - Intronic
951204977 3:19916437-19916459 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
951887720 3:27540152-27540174 TTTAGGAGGCAGAGGCTGGAGGG + Intergenic
951957251 3:28271004-28271026 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
952376614 3:32772971-32772993 CTTGGGGGGCTGAGGCAGGAGGG - Intronic
952820132 3:37479472-37479494 CCTTGGTGGCAGTGGCTTGAAGG + Intronic
953055459 3:39383994-39384016 CCCTGGGGGCAGGCGCTGTAGGG + Intronic
953613505 3:44468669-44468691 CCTCGGGGGGAGGGGGTGGAGGG - Intronic
953886089 3:46715121-46715143 CACTGGGGGCAGAGGAGGGATGG - Intronic
954391208 3:50269065-50269087 CCTAGGGGAAAGAGGCTGGGGGG - Intronic
954622787 3:52005376-52005398 CCTGGTGGGCAGAGGCTGGTGGG + Intergenic
954630108 3:52043513-52043535 CCTGGAGTGCACAGGCTGGAGGG - Intergenic
954635172 3:52067262-52067284 GCATGGGTGCAGAGGCTGGCAGG - Intergenic
954688250 3:52382262-52382284 ACTTGGGGCCAGACGCTGAAGGG - Intronic
954870870 3:53766644-53766666 CCCTGTGGGAAGAGGCTCGAGGG + Intronic
954973028 3:54667378-54667400 CCTCCAAGGCAGAGGCTGGAAGG + Intronic
955596916 3:60601031-60601053 CCCTGCCAGCAGAGGCTGGAAGG + Intronic
957170238 3:76729711-76729733 CATGGGAGGCAGAGGCTGCAGGG - Intronic
957446392 3:80317103-80317125 CCTTTGGGGCAGAGACTATAGGG - Intergenic
958148703 3:89660746-89660768 CCCGGGAGGCAGAGGCTGTAAGG + Intergenic
958818015 3:98938638-98938660 GGTTGGGGGCACAGGTTGGAAGG + Intergenic
959090325 3:101895784-101895806 ACTTGGGGGCTGAGACAGGAGGG - Intergenic
959451387 3:106507393-106507415 ACTTGAGGGCAGAGGGTGGGAGG - Intergenic
959472441 3:106768409-106768431 CCTAGGAGGCAGAGGTTGCAGGG + Intergenic
959574632 3:107921311-107921333 CCCCGGGTGCAGAGGCAGGATGG - Intergenic
960440217 3:117677753-117677775 CCTGGGAGGCTGAGGCAGGAGGG - Intergenic
960630332 3:119724090-119724112 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
960638111 3:119803831-119803853 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
960658084 3:120028401-120028423 CCTTAGTGGCATAGTCTGGAAGG - Intronic
960794558 3:121471664-121471686 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
961115208 3:124323394-124323416 CCCTGTGGGCAGGGGGTGGATGG + Intronic
961448866 3:126993431-126993453 CTTTGTGGGCAGCTGCTGGATGG + Intronic
961558177 3:127710886-127710908 CCTTGGGCGCAGCGGCTGCCTGG - Intronic
961645198 3:128389115-128389137 CCATGGGGATGGAGGCTGGAGGG + Intronic
961805221 3:129484276-129484298 CCTGGGGTGCAGAAGGTGGAGGG - Intronic
961818749 3:129564573-129564595 CTATGGTGGCAGAGGCTAGAGGG - Intronic
961927668 3:130498511-130498533 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
962030984 3:131600053-131600075 TCTTGGGGGCTGAGGGTGAAAGG + Intronic
962126493 3:132624760-132624782 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
962282377 3:134061567-134061589 CCAGGGAGGCAGGGGCTGGATGG + Intergenic
963716254 3:148807680-148807702 CGGAGGAGGCAGAGGCTGGAAGG + Intronic
963956953 3:151264669-151264691 GGTAGGGGGCACAGGCTGGAAGG - Intronic
964580327 3:158227293-158227315 TCTTGGGGGCAGAGGGAAGAGGG - Intronic
964790464 3:160449804-160449826 CCTTCGGGGCAGAGGAGGGCGGG - Exonic
964893953 3:161571692-161571714 ACTTGGGAGCAGAGGCTAGGAGG - Intergenic
964976728 3:162630319-162630341 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
965136588 3:164779935-164779957 ACTTGGCCGCAGAGGCTTGAAGG + Intergenic
965370487 3:167856051-167856073 ACTAGGGAGCAGAGGCTGCAGGG - Intergenic
965571363 3:170177081-170177103 CCTTAGGGGCAGAGGGGGAAGGG - Intronic
965688788 3:171333479-171333501 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
966432422 3:179846092-179846114 CCCTGGAGGCAGAGGTTGCAGGG + Intronic
966516159 3:180822903-180822925 CCTTGAAGGCAGAGGGTGGGAGG + Intronic
967924344 3:194634282-194634304 CCTGGGAGGCGGAGGCTGCAGGG - Intergenic
968074324 3:195808289-195808311 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
968076853 3:195820693-195820715 CGATGGAGGCAGAGGCTGGAGGG - Intergenic
968263648 3:197344923-197344945 GCATGTGGGCAGAGGCTGAAAGG - Intergenic
968293554 3:197556224-197556246 CCTCGCGGGCTGAGGCCGGAGGG + Intronic
968404022 4:323858-323880 CCTGGGAGGCTGAGGCAGGAGGG + Intergenic
968461244 4:726076-726098 GCTGTGGGGCAGAGGCTGGCGGG + Intronic
968693906 4:2011290-2011312 CCCAGGAGGCAGAGGTTGGAGGG + Intronic
968912027 4:3481270-3481292 GCTTGGAGGAAGAGGCTGGCAGG + Intronic
968967341 4:3775772-3775794 CCTTGGGGGCACGGGGAGGACGG + Intergenic
969108686 4:4827905-4827927 CGATGCGGGCAGAGACTGGAGGG + Intergenic
969261150 4:6034723-6034745 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
969338707 4:6527453-6527475 CCTTGGCCACAGAGGCTGCATGG - Intronic
969520500 4:7675356-7675378 CCCTGGGGGCACAGTCTGGAGGG - Intronic
969856347 4:10002775-10002797 CCCTGGAGGCAGAGGTTGCAGGG + Intronic
969979736 4:11142291-11142313 CTTTGGAGGCTGAGGCAGGAGGG + Intergenic
970547124 4:17140990-17141012 CCCAGGAGGCTGAGGCTGGAGGG + Intergenic
970624711 4:17863992-17864014 ACTTGAGGGCAGAGGGTGGGAGG + Intronic
970709295 4:18843037-18843059 CATGGGGGGCAGCTGCTGGAGGG + Intergenic
971234607 4:24829782-24829804 GCTTGGGTGCAGCGGCTGGGGGG - Intronic
971689449 4:29814245-29814267 CTTGGGGGGCTGAGGCAGGAGGG - Intergenic
971915264 4:32862093-32862115 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
972052179 4:34750927-34750949 CTTTGGGGGCCGAGGCAGGCGGG + Intergenic
972382986 4:38536389-38536411 CTTTGGGGGCAGAGACTGGTCGG + Intergenic
972447636 4:39161041-39161063 CTGTGGGAGCTGAGGCTGGAAGG - Intergenic
972566703 4:40276084-40276106 CTTTGGGGGCAGAGGAGGGTGGG - Intergenic
973160250 4:47007062-47007084 CCTAGGAGGCCGAGGCTGTAGGG + Intronic
973247098 4:48020592-48020614 ATTTGGGTGCAGAGGCTGAAGGG + Intronic
973320239 4:48802643-48802665 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
974090505 4:57305817-57305839 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
978183554 4:105831858-105831880 CCCTGGAGGCAGAGGTTGCAGGG + Intronic
978352030 4:107830025-107830047 ACTTGAGGGCAGAGGGTGGGAGG - Intronic
978504631 4:109443482-109443504 TCTGGGAGGCAGAGGTTGGAGGG - Intronic
978569328 4:110119028-110119050 CCTTTGTGGCCCAGGCTGGAGGG - Intronic
978620298 4:110630139-110630161 CGTTGGGGGCAGAGGCGGAGAGG + Intronic
978689790 4:111493573-111493595 ACCTGGGGGTAGAGGCTGGTTGG - Intergenic
978787904 4:112630440-112630462 CCTGGGAGGCAGAGGCTTCAGGG + Intronic
980040328 4:127932001-127932023 CTTAGAGGGCTGAGGCTGGAAGG + Intronic
980134381 4:128845846-128845868 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
980693160 4:136321403-136321425 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
980790076 4:137609245-137609267 TGTTGGGGGCAGAGGGGGGAGGG - Intergenic
981057536 4:140380271-140380293 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
981221996 4:142248024-142248046 CCTGGAGGGCAGGGGCAGGAGGG - Intronic
981312747 4:143312989-143313011 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
981520208 4:145652975-145652997 CCTGGGAGGCTGAGGCAGGAGGG - Intronic
981647481 4:147017149-147017171 GATTGGGAGCAGAGGCTGAAAGG + Intergenic
982217125 4:153092075-153092097 CCGTGGAGGCAGAGACTGGAGGG - Intergenic
982617834 4:157663818-157663840 ACTTGGGGCCAGTGGCTAGATGG - Intergenic
982631647 4:157838014-157838036 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
982687345 4:158506808-158506830 CCTGGGAGGCAGAGGTTGCAAGG + Intronic
982781380 4:159494582-159494604 CTTTGGAGGCTGAGGCAGGAGGG + Intergenic
983018677 4:162647252-162647274 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
983683498 4:170380199-170380221 ACTTGAGGGTAGAGGGTGGAAGG - Intergenic
984021000 4:174484704-174484726 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
984729851 4:183057804-183057826 CTTTGGGTGCAGAGGATGGGAGG - Intergenic
984952032 4:185015118-185015140 GCTTGGGGGCAGGGGATGGATGG - Intergenic
985278994 4:188268793-188268815 ACTTGGAGGAAGAGGATGGAAGG + Intergenic
985482360 5:122493-122515 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
985861157 5:2471607-2471629 CCTTGGGGACAGTGGAAGGAAGG + Intergenic
985877765 5:2613251-2613273 CCCTGGGAGCCGAGGCAGGAGGG - Intergenic
986347691 5:6850110-6850132 CCTTGAGGGAAGAGGCTCGTGGG + Intergenic
986691869 5:10319949-10319971 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
987261824 5:16211923-16211945 CCTTGGAGACAGTGGCTGGAAGG - Intergenic
987384806 5:17319083-17319105 CCCAGGAGGCAGAGGCTGCAGGG - Intergenic
987476157 5:18394367-18394389 ACTTGGGGGCAGAGTCCGGCAGG + Intergenic
988124050 5:27006014-27006036 ACTTGGAGGTGGAGGCTGGAAGG + Intronic
988140422 5:27232224-27232246 CCCTGGAGGCAGAGGCTGCAAGG - Intergenic
988140822 5:27237512-27237534 CCCAGGAGGCAGAGGCTGCAGGG + Intergenic
988201867 5:28078247-28078269 ACTTGAGGGCAGAGGATGGGAGG - Intergenic
988342152 5:29986427-29986449 CCTGGGAAGCAGAGGCTGAAGGG + Intergenic
988431624 5:31125746-31125768 CCTGGGAGGCGGAGGCTGCAGGG - Intergenic
988856803 5:35234965-35234987 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
988890469 5:35610871-35610893 CCTTGGAGGCAGAGGTTGCAGGG + Intergenic
990215008 5:53521168-53521190 ACTTGAGGGTAGAGGATGGAAGG + Intergenic
990407530 5:55505979-55506001 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
992465792 5:77002755-77002777 CCCTGGAGGCAGAGGCTGTAGGG + Intergenic
992911294 5:81398473-81398495 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
993139001 5:84006567-84006589 ACTTGAGAGCAGAGGTTGGAAGG + Intronic
993310034 5:86318090-86318112 CCTGGGAGGCAGAGGATGCAGGG - Intergenic
993633862 5:90320353-90320375 CTTTGAGGGCAGAGGGTGGAAGG - Intergenic
994010617 5:94897825-94897847 CCTTGAGGGCAGAGTTTGGGAGG - Intronic
994796539 5:104307841-104307863 CCTTCAGGGCAGAGGCTTGGCGG - Intergenic
994916719 5:105990370-105990392 CCCGGGTGGCAGAGGCTGCAGGG - Intergenic
995170622 5:109107478-109107500 ACTTGAGGGTAGAGGGTGGAGGG - Intronic
995874653 5:116777808-116777830 CTTTGGGGGAAGAGTTTGGAAGG - Intergenic
996263581 5:121505910-121505932 CCTTGGGGGAAAAGGTGGGAGGG + Intergenic
996847411 5:127915455-127915477 CCCGGGAGGCAGAGGCTGCAGGG - Intergenic
997103843 5:130996046-130996068 CCTTGGAGACAGCGGCTGGCGGG - Intergenic
997116657 5:131132462-131132484 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
997325855 5:133020366-133020388 CCTGGGAGGCAGAGGCTGCAAGG + Intronic
997361326 5:133296930-133296952 CCTTGGGGGCTGGGGCTGGTGGG + Intronic
997514412 5:134476504-134476526 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
997663576 5:135608740-135608762 CCTTGGGAGAAGAGGGAGGATGG - Intergenic
998243478 5:140473102-140473124 CCCAGGAGGCAGAGGCTGCAGGG - Intronic
999241256 5:150128757-150128779 CATTAGGGGCAAAGCCTGGAGGG - Intronic
999243061 5:150138654-150138676 GGTGGGGAGCAGAGGCTGGAGGG - Intronic
999280209 5:150360311-150360333 CCTTTGGAGCAGAGGCCAGAGGG - Intronic
999294884 5:150452978-150453000 GAATGGGGGCTGAGGCTGGAGGG + Intergenic
999834951 5:155359707-155359729 ACTTGAGGGTAGAGGATGGAAGG + Intergenic
1000317383 5:160105460-160105482 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1000330315 5:160200351-160200373 CGTTGTGGGCAGAGGCTGCAGGG + Intronic
1000828984 5:166080508-166080530 TTTTGGAGGCAGAGGCAGGAAGG - Intergenic
1001242353 5:170080338-170080360 CCTTGTGGGTGGAGGATGGATGG + Intronic
1001503480 5:172257135-172257157 CCTTGAGGGCAGAGGATGGGAGG - Intronic
1001625153 5:173126214-173126236 CCTGGGAGGCAGAGGCTGCAGGG - Intronic
1001825818 5:174744132-174744154 CCTAGGAGGCTGAGGCAGGAGGG + Intergenic
1001943288 5:175755881-175755903 CCTGGGAAGCAGAGGCTGCAGGG + Intergenic
1002127947 5:177060730-177060752 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1002182306 5:177437028-177437050 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1002207525 5:177573841-177573863 CCTTGGAGGCAGAAGTTGCAGGG + Intergenic
1002819135 6:707414-707436 ACTGGGGGGAAGAGGCTGCAGGG + Intergenic
1002911399 6:1493817-1493839 CTTGGGGGGCTGAGGCAGGAGGG - Intergenic
1002924759 6:1599029-1599051 CCTGGGGAGCAGAGGCTGCCTGG - Intergenic
1003101219 6:3177828-3177850 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1003253755 6:4456669-4456691 CCTTGAGGGCAGAGCCTTCATGG + Intergenic
1003481741 6:6540616-6540638 CTTGGGAGGCTGAGGCTGGAGGG - Intergenic
1004227003 6:13794724-13794746 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1004547921 6:16616462-16616484 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
1004650427 6:17602104-17602126 CCTGGGAGGCGGAGGCTGCAGGG - Intronic
1004929324 6:20446639-20446661 CCTAGGAGGCAGAGGTTGCAGGG - Intronic
1005102073 6:22182094-22182116 ACTTGAGGGTAGAGGGTGGAAGG - Intergenic
1005937384 6:30533737-30533759 CCTGGGGGGCGGAGGTTGCAGGG - Intergenic
1006010221 6:31036737-31036759 CCTTGGGGGAAAAGGCTGACCGG + Intergenic
1006168079 6:32077247-32077269 CCTTGGGGCCTGAGGTTGTAGGG - Intronic
1006620495 6:35360642-35360664 GCTTGTGAGCAGAGGCTGAAAGG + Intronic
1006818326 6:36869224-36869246 CTTTGGAGGCTGAGGCGGGAGGG - Intronic
1006920249 6:37623185-37623207 CCTGGGGTGTAGAGGCAGGAAGG + Intergenic
1006987914 6:38189061-38189083 CCTGGAGGGCAGAGGATGCAGGG - Intronic
1009893321 6:69715769-69715791 ACTGGAGGGCAGAGGGTGGAAGG - Intronic
1010022142 6:71173209-71173231 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1010230423 6:73529959-73529981 CCTGGGAGGTAGAGGCTGCAGGG - Intergenic
1010231516 6:73539364-73539386 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1010389023 6:75315377-75315399 CCTTAGGGGTAGTGGCTAGAAGG + Intronic
1010391208 6:75339870-75339892 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1010710945 6:79173524-79173546 CCATGGAGGCAGAGATTGGAGGG + Intergenic
1011275145 6:85623486-85623508 TCTGGGAGGCAGAGGCTGCAGGG + Intronic
1012638090 6:101572922-101572944 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1013074520 6:106759491-106759513 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1013369202 6:109455389-109455411 TCTTGGGGGTGGAGGGTGGAAGG + Intronic
1014109773 6:117607538-117607560 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1014335379 6:120127214-120127236 TCTTGAGGGTAGAGGCTGGGAGG - Intergenic
1014693099 6:124586436-124586458 ACTTGAGGGCGTAGGCTGGAAGG + Intronic
1015067052 6:129042660-129042682 GCTTGGGGGCAGAGACTGACTGG - Intronic
1015284109 6:131465336-131465358 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1015402278 6:132799916-132799938 ACTTGAGGGCAGAGTCTGGATGG - Intergenic
1015970573 6:138739298-138739320 CTTGGGGGGCTGAGGCAGGAGGG - Intergenic
1016466297 6:144328857-144328879 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1016546736 6:145232486-145232508 ACTTGAGGGCAGAGGGTGGGAGG - Intergenic
1017103585 6:150867871-150867893 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1017654659 6:156615909-156615931 CCCGGGGGGCAGAGGTTGCAGGG + Intergenic
1018005012 6:159613536-159613558 CCTGGGTGACAGCGGCTGGAAGG + Intergenic
1018087086 6:160312193-160312215 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1018520052 6:164639121-164639143 CCTTGAGGGCAGAGGGTAGGAGG - Intergenic
1018701778 6:166432917-166432939 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1019011967 6:168849879-168849901 CCTTGTGGGCAGAGGTGGCACGG + Intergenic
1019011974 6:168849903-168849925 CCTTGTGGGCAGAGGTGGCATGG + Intergenic
1019011987 6:168849951-168849973 CCTTGTGGGCAGAGGTGGCATGG + Intergenic
1019011994 6:168849975-168849997 CCTTGTGGGCAGAGGTGGCACGG + Intergenic
1019012001 6:168849999-168850021 CCTTGTGGGCAGAGGTGGCACGG + Intergenic
1019012021 6:168850071-168850093 CCTTGTGGGCAGAGGTGGCACGG + Intergenic
1019012032 6:168850119-168850141 CCTTGTGGGCAGAGGTGGCACGG + Intergenic
1019012051 6:168850191-168850213 CCTTGTGGGCAGAGGTGGCACGG + Intergenic
1019012058 6:168850215-168850237 CCTTGTGGGCAGAGGTGGCACGG + Intergenic
1019012071 6:168850263-168850285 CCTTGTGGGCAGAGGTGGCACGG + Intergenic
1019012077 6:168850287-168850309 CCTTGTGGGCAGAGGTGGCACGG + Intergenic
1019012084 6:168850311-168850333 CCTTGTGGGCAGAGGTGGCACGG + Intergenic
1019012109 6:168850407-168850429 CCTTGTGGGCAGAGGTGGCACGG + Intergenic
1019012115 6:168850431-168850453 CCTTGTGGGCAGAGGTGGCACGG + Intergenic
1019012122 6:168850455-168850477 CCTTGTGGGCAGAGGTGGCACGG + Intergenic
1019012128 6:168850479-168850501 CCTTGTGGGCAGAGGTGGCATGG + Intergenic
1019012135 6:168850503-168850525 CCTTGTGGGCAGAGGTGGCACGG + Intergenic
1019012147 6:168850551-168850573 CCTTGTGGGCAGAGGTGGCACGG + Intergenic
1019012154 6:168850575-168850597 CCTTGTGGGCAGAGGTGGCATGG + Intergenic
1019197822 6:170292148-170292170 GGTTGGGGGCCGGGGCTGGAGGG - Intergenic
1019503390 7:1376952-1376974 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1019526528 7:1482969-1482991 CCCCGAGGGCAGGGGCTGGATGG - Intronic
1019558884 7:1646103-1646125 CCTGGGAGGCAGAGGCTGCAGGG - Intergenic
1019672834 7:2291520-2291542 CCCAGGAGGCAGAGGCTGCAGGG + Intronic
1019822890 7:3259168-3259190 CCTGGGAGGCTGAGGCCGGAGGG - Intergenic
1020001244 7:4757166-4757188 CCTTGAGGACAGAGGCCCGAAGG - Exonic
1020136665 7:5591842-5591864 CTTTGGGGGAGGAGGATGGAGGG + Intergenic
1020166445 7:5811309-5811331 CCTGGGAGCCAGAGGCTGCAGGG - Intergenic
1020166973 7:5814922-5814944 CCTGGGAGGCAGAGGCTGCAGGG + Intergenic
1020176324 7:5885042-5885064 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1020190871 7:5996477-5996499 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1020651001 7:10876119-10876141 ACTTGAGGGTAGAGGGTGGAGGG - Intergenic
1020705949 7:11544264-11544286 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1021158754 7:17245536-17245558 CCTGGGAGGCCGAGGCTGCAGGG + Intergenic
1021561013 7:21968647-21968669 CCTGGGAGGCGGAGGCTGCAGGG + Intergenic
1021679474 7:23115617-23115639 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1022054651 7:26717754-26717776 CCTCGGGGGTAGAGGTTGCAGGG + Intronic
1022361431 7:29663358-29663380 CCTGGGAGGCGGAGGCTGCAGGG - Intergenic
1022477920 7:30723805-30723827 CAATGAGGGCAGGGGCTGGAGGG + Intronic
1022665215 7:32404459-32404481 CCCAGGAGGCAGAGGCAGGAGGG - Intergenic
1022822648 7:33976226-33976248 CCTGGGAGTCAGAGGCTGCAGGG - Intronic
1023352235 7:39332271-39332293 GCATAGGGGCAGAGGCTGTAAGG - Intronic
1023647165 7:42330092-42330114 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1023787480 7:43722473-43722495 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1023817591 7:43962282-43962304 CCTTGAGTGCAGAGACAGGAAGG - Intergenic
1023849824 7:44144457-44144479 CCCTTGGGGCAGAGGCTTGGGGG + Exonic
1024027324 7:45423829-45423851 GCATGGGGGCAGAGCCAGGAGGG - Intergenic
1024454196 7:49584377-49584399 ACATGGAGGCAGAGACTGGAGGG + Intergenic
1024573643 7:50746774-50746796 CCCGGGGGGCAGAGACTGGGTGG - Intronic
1026064668 7:67059846-67059868 CCCAGGGGGCAGAGGTTGCAGGG - Intronic
1026142902 7:67721446-67721468 TCTTGGAGCCAGAGGCTGCATGG + Intergenic
1026286008 7:68963446-68963468 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1026339313 7:69421704-69421726 CATTGGGTGATGAGGCTGGAAGG - Intergenic
1026576228 7:71573823-71573845 ACTTGAGGGCAGAGGGTGGGAGG - Intronic
1026818190 7:73528790-73528812 CCTGGGCGGCAGAGGTTGCAAGG - Intergenic
1026901424 7:74039518-74039540 CCTTGGTGACAGAGGGTGGGTGG + Intronic
1027005546 7:74689789-74689811 CCCAGGGGGCAGAGGTTGCAGGG - Intronic
1027202158 7:76070979-76071001 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1027361807 7:77416612-77416634 CCTTCGGGGCTGAGGATAGAGGG + Intergenic
1027390838 7:77702039-77702061 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1028521030 7:91731006-91731028 CCTGGGAGGCCGAGGCTGGCGGG - Intronic
1028758315 7:94464111-94464133 CATTGGTGGCAGAAGCAGGAAGG - Intergenic
1029125842 7:98294867-98294889 CCTGGGTGGCAGGTGCTGGAAGG - Intronic
1029133630 7:98352564-98352586 CCCTGGAGGCAGAGGCTGCAGGG + Intronic
1029291336 7:99504514-99504536 CCTCGGGAGCCAAGGCTGGAAGG - Intergenic
1029596908 7:101542807-101542829 CCTTAGGGACAGCGGCTCGAGGG - Intronic
1029742215 7:102497156-102497178 CCTTGAGTGCAGAGACAGGAAGG - Intronic
1029760205 7:102596321-102596343 CCTTGAGTGCAGAGACAGGAAGG - Intronic
1029831866 7:103268809-103268831 CCCAGGAGGCAGAGGCTGCAGGG + Intergenic
1031622492 7:123951695-123951717 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1031936139 7:127737497-127737519 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1032077808 7:128844328-128844350 CATAGGGGGCAGAGGCCAGAGGG + Intronic
1032200418 7:129818647-129818669 CCTGGGAGGCAGAGGTTGCAAGG - Intergenic
1032271173 7:130408083-130408105 CCTTGGGGAAGGAGGCAGGAGGG - Intronic
1032376745 7:131427627-131427649 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1032386933 7:131531654-131531676 CCATGAGGGCAGAGGTTGGCGGG - Intronic
1032414733 7:131727361-131727383 CCTTGGGGCTAGAGGCTGCAAGG - Intergenic
1032559460 7:132873487-132873509 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1032862536 7:135894102-135894124 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1033277917 7:139986514-139986536 ACTTGGGGGGAGAGGTGGGAAGG - Intronic
1033769045 7:144527931-144527953 ACTTGAGGGCAGAGGGTGGGAGG + Intronic
1033770892 7:144550136-144550158 TTTTGGGGGCAGAGAGTGGAGGG + Intronic
1034671629 7:152863159-152863181 CCCTGGAGGCAGAGGTTGCAGGG - Intergenic
1034964556 7:155383152-155383174 CCTGCAGGGTAGAGGCTGGAGGG - Intronic
1034989221 7:155537246-155537268 CCTCGGAAGGAGAGGCTGGAAGG - Intergenic
1035020447 7:155797324-155797346 ACTTGGGGCCCGGGGCTGGAGGG - Intergenic
1035459625 7:159030935-159030957 CCTTGGGGGCAGAGGCTGGAGGG + Intronic
1035521066 8:275259-275281 CCTGTGGGGCAGAGGCTTGCAGG + Intergenic
1035700764 8:1638037-1638059 GCCTGGAGGGAGAGGCTGGAAGG + Intronic
1035772259 8:2156968-2156990 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1036181949 8:6593428-6593450 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1036696817 8:10980200-10980222 CCTTCCAGGCAGAGGCAGGAAGG + Intronic
1037056852 8:14453025-14453047 CCCAGGAGGCAGAGGCTGCAGGG + Intronic
1037524863 8:19714914-19714936 ACTTGAGGGTAGAGGATGGAAGG - Intronic
1037752342 8:21690998-21691020 CCTTCCATGCAGAGGCTGGAAGG + Exonic
1037858007 8:22385345-22385367 CCAGGAGGGCAGAGACTGGAGGG - Intronic
1038116774 8:24564760-24564782 ACTTGAGGGTAGAGGGTGGAAGG + Intergenic
1038553736 8:28491769-28491791 CCTTGGGGGCAGAGGCGGTGAGG + Intergenic
1039347503 8:36723570-36723592 CCTGGGAGGCAGAGGATGCAGGG + Intergenic
1039495013 8:37974070-37974092 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1039495639 8:37978081-37978103 CCTAGGAGGCTGAGGCAGGAGGG - Intergenic
1039807435 8:41012633-41012655 GCATAGAGGCAGAGGCTGGAGGG - Intergenic
1039965101 8:42278278-42278300 CCTGGGTGGCTGAGGGTGGACGG + Intronic
1040029389 8:42810479-42810501 CCTAGGAGGTAGAGGCTGCAGGG + Intergenic
1040581485 8:48702160-48702182 ACTTCTTGGCAGAGGCTGGAAGG + Intergenic
1041253742 8:55960839-55960861 CTTTGGGGGAAGGGGCTGGGTGG + Intronic
1041266363 8:56069372-56069394 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1042185672 8:66134454-66134476 TCCTGGGGCCAGAGGCTGGAGGG + Intronic
1042207427 8:66343363-66343385 CCCAGGAGGCAGAGGCTGCAGGG + Intergenic
1044729736 8:95220277-95220299 CCTTGAGGATGGAGGCTGGATGG - Intergenic
1045341334 8:101257358-101257380 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1045689694 8:104747432-104747454 CCTTGGAGGCGGAGGTTGCAGGG + Intronic
1045718831 8:105081573-105081595 ACTTGAGGGAAGAGGCTAGAAGG + Intronic
1045989981 8:108295689-108295711 CCTGGGAGGTAGAGGCTGCAGGG - Intronic
1046195350 8:110856706-110856728 ACATGAGGGCAGAGGGTGGAAGG + Intergenic
1046468924 8:114642794-114642816 CCTGCGAGGCAGAGGTTGGAGGG - Intergenic
1046720385 8:117612485-117612507 CCTGGGAGGCAGAGGTTGGGAGG - Intergenic
1046748025 8:117896941-117896963 ACATGGAGGCAGAGGCTGGGGGG - Intronic
1046936101 8:119887247-119887269 CCCTGGAGGCAGAGGTTGCAGGG - Intronic
1047314057 8:123716159-123716181 CCCGGGAGGCAGAGGCTGCAGGG - Intronic
1047322195 8:123796983-123797005 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1047681071 8:127254580-127254602 CCTGGAAGGCAGAGGCTGCAGGG + Intergenic
1048017322 8:130509102-130509124 TCCTGGAGGCAGAGACTGGAGGG - Intergenic
1048317267 8:133371509-133371531 GGTTGGGGGCATAGGCAGGAGGG + Intergenic
1048323763 8:133422792-133422814 CCTTGGCCGCTGAGTCTGGACGG - Intergenic
1048716102 8:137272030-137272052 GCTTGGGGGCAGAGGGTGGGAGG + Intergenic
1048849268 8:138629230-138629252 CCTGGGAGGCAGAGACTGCAGGG - Intronic
1049178075 8:141206230-141206252 TCTTGGGTGCAGAGTCTGGGCGG + Intergenic
1049235846 8:141511888-141511910 CCCCGGAGGCAGAGGTTGGAGGG + Intergenic
1049614262 8:143569289-143569311 CCTGGGAGGGAGAGACTGGAAGG + Intronic
1049614294 8:143569364-143569386 CCTGGGAGGGAGAGACTGGAAGG + Intronic
1049672950 8:143877859-143877881 CGTGGGAGGCAGAGGCAGGAAGG - Intronic
1049678215 8:143902968-143902990 CTCTGAGGACAGAGGCTGGATGG - Intergenic
1049738661 8:144223481-144223503 CTTGGGGGGCTGAGGCGGGAGGG - Intronic
1050264100 9:3871739-3871761 CCTTGGGGCCTGTGACTGGAGGG + Intronic
1050342702 9:4656329-4656351 CTTGTGGGGCTGAGGCTGGAGGG + Intronic
1051105016 9:13569522-13569544 CCGAGGGGGCTGGGGCTGGAGGG - Intergenic
1051247061 9:15122590-15122612 CCCAGGAGGCAGAGGCTGCAGGG + Intergenic
1051258935 9:15243027-15243049 CTTTGGTGGCAGAGGCAGCAAGG + Intronic
1051350152 9:16191414-16191436 ACTTGGGAGCAGAGGGAGGAAGG + Intergenic
1051877659 9:21808479-21808501 CCTTGGGGGCTGAGGTAGGAGGG + Intronic
1052317102 9:27126793-27126815 GATTGGGGCCAGAGGATGGAAGG + Intronic
1055243894 9:74217703-74217725 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1055395445 9:75869016-75869038 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1056170751 9:83981629-83981651 GATTGTGGGCGGAGGCTGGAAGG - Intronic
1056232904 9:84565163-84565185 ACTTGGAGGCTGAGGCAGGAGGG + Intergenic
1056486322 9:87061832-87061854 CCTGGGAGGTAGAGGCTGCAGGG - Intergenic
1056654030 9:88494858-88494880 CCCGGGAGGCAGAGGCTGCAGGG - Intergenic
1056765154 9:89440513-89440535 CCTTGGGGGCTGAGTGTGGAGGG - Intronic
1057632452 9:96731536-96731558 CCTAGGAGGCAGAGGTTGCAGGG - Intergenic
1058440145 9:104999012-104999034 CCCAGGAGGCAGAGGCTGCAGGG + Intergenic
1058484196 9:105427009-105427031 CCTAGGAGGCGGAGGTTGGAGGG - Intronic
1059115034 9:111593759-111593781 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1059251550 9:112891163-112891185 CCACCGGGGCAGGGGCTGGAAGG + Intergenic
1059347522 9:113639712-113639734 CTTGGGGGGCTGAGGCAGGAGGG + Intergenic
1059653594 9:116337268-116337290 TCTTGAGGGCTGAGGCTGCAGGG + Intronic
1059755965 9:117293679-117293701 CCTTGGGTGCTAAGGCTGGGAGG - Intronic
1060268820 9:122127321-122127343 CTTTGGGTGCTGAGGCTGGGGGG + Intergenic
1060275234 9:122177506-122177528 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1060551897 9:124489631-124489653 CGTTGCGGGCAGAGGTAGGAGGG + Intronic
1060691723 9:125667393-125667415 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1060813059 9:126620676-126620698 CCTTGGGGGCAGACGGAGGGTGG + Intronic
1061234209 9:129333145-129333167 CCTGGGAGGCAGAGGCTGCGGGG - Intergenic
1061260753 9:129479716-129479738 CCTTGTGGGCAGTGGAAGGAAGG + Intergenic
1061351898 9:130072045-130072067 CCGAGGAGGCAGAGGCTGCAGGG - Intronic
1061364294 9:130163388-130163410 CCTGGGAAGCAGAGGCTGCAGGG - Intergenic
1061375240 9:130220111-130220133 GGCTGGGGGCAGAGGCTGGCAGG + Intronic
1061391093 9:130317568-130317590 CCCAGGAGGCAGAGGTTGGAGGG - Intronic
1061481259 9:130898753-130898775 GGTTGGGGGCAGAGGTGGGAAGG - Intergenic
1061582295 9:131545614-131545636 CCATGGAGGCAGGAGCTGGAGGG + Intergenic
1061610547 9:131742553-131742575 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1061864398 9:133484998-133485020 GCTTGGGGGCAGGATCTGGAGGG + Intergenic
1061966969 9:134020447-134020469 CCTGGGAGGCTGAGGCAGGAGGG - Intergenic
1061991001 9:134158748-134158770 CCCTGGGGCAAGAGGGTGGAAGG + Exonic
1062109873 9:134776455-134776477 ACTTGGAAGCAGAGGGTGGAAGG + Intronic
1062307767 9:135919475-135919497 CCATGGGGGCACCCGCTGGAGGG - Intergenic
1062447879 9:136603288-136603310 CCTGGGGGGCAGAGGGAGGTTGG + Intergenic
1062478998 9:136742909-136742931 CCTTGGCGGCTGAGGGAGGAGGG - Exonic
1062490854 9:136804254-136804276 GCTGGGGGCCAGCGGCTGGAGGG + Intronic
1062573088 9:137194492-137194514 CCGTGGGGGCTGGGCCTGGAGGG - Intronic
1185778804 X:2828827-2828849 GCTTGCGGGCAGGGGCTGCAGGG + Exonic
1185802990 X:3030161-3030183 GCTTGGAAGCAGAGGCAGGAAGG + Intronic
1185972707 X:4682297-4682319 CCTGGGAGGCAGAGGCTGCACGG + Intergenic
1186051690 X:5603334-5603356 CCCTGGAGGCAGAGGTTGCAAGG + Intergenic
1186175443 X:6921306-6921328 CCTTGGAGGTTGAGGCTGCAGGG + Intergenic
1186309444 X:8301990-8302012 CCTTGGGGAAGGAGGTTGGAAGG - Intergenic
1187115867 X:16350055-16350077 CCTGGGAGGCGGAGGCTGCAGGG - Intergenic
1187262135 X:17695533-17695555 CATAGGGGGAAAAGGCTGGAAGG + Intronic
1187342811 X:18436436-18436458 CCTTGGGGGAAGAGGTGGGAAGG + Intronic
1187381614 X:18807103-18807125 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1187424206 X:19162513-19162535 CTTTGGAGGCCGAGGCAGGAGGG - Intergenic
1189201226 X:39197253-39197275 CCTTCATGGCAGAGGCTGGATGG + Intergenic
1189402829 X:40688139-40688161 CCTAGGAGGCAGAGGTTGGGAGG + Intronic
1189576563 X:42359800-42359822 CCATAGAGGCAGAGACTGGAGGG - Intergenic
1189582567 X:42422746-42422768 CTCTGGGGGCATAGGGTGGAAGG + Intergenic
1189638734 X:43043917-43043939 CCTTGAGGGTAGAGGGTGGGGGG - Intergenic
1190213588 X:48466473-48466495 GTTTGGGGGCAGAGTCTGGGAGG + Intronic
1190214046 X:48468460-48468482 GCTTGGGGGCCCAGGCGGGAAGG - Intronic
1191611443 X:63118829-63118851 CCCGGGAGGCAGAGGCTGCAGGG - Intergenic
1192119970 X:68446401-68446423 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1192410511 X:70929164-70929186 CCTAGGAGGCAGAGGTTGCAGGG - Intronic
1192767185 X:74152670-74152692 CCTTGAGGGTGGAGGTTGGAAGG + Intergenic
1192837835 X:74820859-74820881 ACCTGAGGGCAGAGGGTGGAAGG + Intronic
1193790163 X:85807927-85807949 CCATGGTGGCAGAGGCAGCATGG + Intergenic
1195505019 X:105646892-105646914 CTTTGGGAGCAAAGGCTGGCTGG - Intronic
1195577693 X:106468806-106468828 CCACAGGGGCAGAGCCTGGATGG + Intergenic
1195714322 X:107803669-107803691 CCCAGGGGGCAGAGGTTGCAGGG + Intergenic
1196947536 X:120842592-120842614 CCTTGAGGGTAGGGGCTGTATGG + Intergenic
1197257467 X:124279135-124279157 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1198462359 X:136876197-136876219 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1198636720 X:138710363-138710385 CCTTGGAGGTGGAAGCTGGAGGG + Intronic
1198895187 X:141446297-141446319 ACTTGAGGGTAGAGGATGGAAGG - Intergenic
1199225573 X:145369227-145369249 CCTAGGAGGCAGAGGTTGCAGGG - Intergenic
1199338392 X:146646195-146646217 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1199764785 X:150933256-150933278 CCTAGGAGGCGGAGGCTGCAGGG + Intergenic
1200070517 X:153526868-153526890 CCTTGGGAGTACAGGCTGGGGGG - Intronic
1200073122 X:153538683-153538705 GCATGGGGGCAGGGGCTGGCCGG - Intronic
1201291215 Y:12421678-12421700 GCTTGCGGGCAGGGGCTGCAGGG - Intergenic
1201784875 Y:17764286-17764308 CCTGGAAGGCAGAGGCTGCAGGG - Intergenic
1201816677 Y:18141701-18141723 CCTGGAAGGCAGAGGCTGCAGGG + Intergenic
1202344692 Y:23909107-23909129 CCTGGAAGGCAGAGGCTGCAGGG - Intergenic
1202526076 Y:25760976-25760998 CCTGGAAGGCAGAGGCTGCAGGG + Intergenic