ID: 1035459948

View in Genome Browser
Species Human (GRCh38)
Location 7:159032399-159032421
Sequence GGATGGGCCGGGCTCCCAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 352
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 315}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035459948_1035459962 28 Left 1035459948 7:159032399-159032421 CCGCCTGGGAGCCCGGCCCATCC 0: 1
1: 0
2: 2
3: 34
4: 315
Right 1035459962 7:159032450-159032472 CCTCCACCGCTGCCACACGCAGG No data
1035459948_1035459954 -9 Left 1035459948 7:159032399-159032421 CCGCCTGGGAGCCCGGCCCATCC 0: 1
1: 0
2: 2
3: 34
4: 315
Right 1035459954 7:159032413-159032435 GGCCCATCCTGAGGCAGGCATGG No data
1035459948_1035459955 -8 Left 1035459948 7:159032399-159032421 CCGCCTGGGAGCCCGGCCCATCC 0: 1
1: 0
2: 2
3: 34
4: 315
Right 1035459955 7:159032414-159032436 GCCCATCCTGAGGCAGGCATGGG No data
1035459948_1035459959 1 Left 1035459948 7:159032399-159032421 CCGCCTGGGAGCCCGGCCCATCC 0: 1
1: 0
2: 2
3: 34
4: 315
Right 1035459959 7:159032423-159032445 GAGGCAGGCATGGGACAAGAAGG 0: 1
1: 0
2: 4
3: 35
4: 458
1035459948_1035459960 5 Left 1035459948 7:159032399-159032421 CCGCCTGGGAGCCCGGCCCATCC 0: 1
1: 0
2: 2
3: 34
4: 315
Right 1035459960 7:159032427-159032449 CAGGCATGGGACAAGAAGGCTGG 0: 1
1: 0
2: 2
3: 33
4: 566

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035459948 Original CRISPR GGATGGGCCGGGCTCCCAGG CGG (reversed) Intronic
900086369 1:899778-899800 GGATGAGCCAGGCTCCCTGGGGG - Intergenic
900121863 1:1051678-1051700 GGATGGGCCCGGAGCCCACGAGG + Intronic
900214735 1:1475392-1475414 GGAGGGGCCGGGCTTGCAGAGGG - Intronic
900221945 1:1513742-1513764 GGAGGGGCCGGGCTTGCAGAGGG - Intronic
900469597 1:2847208-2847230 GGATGAGCCGGGCCCCCACGTGG - Intergenic
900776359 1:4588600-4588622 GGATGTGCCAGACTCCCTGGTGG - Intergenic
901462423 1:9399705-9399727 GGATGGGCTGAGCTGCCAGCCGG - Intergenic
902625643 1:17674563-17674585 GGGTGGGCCAGGCTCTCTGGAGG + Intronic
902635102 1:17729760-17729782 GGATGAGCTGGGCTACCAGCTGG + Intergenic
903142068 1:21344992-21345014 GGCTGGGTCGGGCTCGCGGGTGG - Intronic
903338266 1:22638936-22638958 GGATGCCACGGGCTCCGAGGGGG - Exonic
903555199 1:24187758-24187780 GGATCCGCCGGGATCCCCGGGGG - Intronic
903766713 1:25739940-25739962 GGATGGGGAGGGCTTCAAGGGGG - Intronic
905022230 1:34825789-34825811 GGACAGGCCTGGCTGCCAGGTGG + Intronic
905287154 1:36889018-36889040 GCATGGGCCTGGCACGCAGGAGG - Intronic
905626998 1:39495729-39495751 GGAGGGGCCGGGCTGCCCTGAGG - Intronic
905669938 1:39785042-39785064 GGAGGGGCCGGGCTGCCCTGAGG + Intronic
906805548 1:48776529-48776551 GGAGGGGCCGGGGGCCCGGGCGG - Intronic
907045358 1:51297096-51297118 GCATGGGTGGGGCTGCCAGGTGG - Intronic
910188867 1:84574526-84574548 GGAGGGGCGGGGCTCCGGGGCGG + Intergenic
912879090 1:113390866-113390888 GGAACGGCCGGGCCCCCAGCGGG + Intronic
916725215 1:167517246-167517268 GGCTGTGCCTGGCTCCCTGGTGG + Intronic
917796142 1:178534192-178534214 GCATGGGGAGGGCTCTCAGGTGG - Intronic
920710461 1:208289601-208289623 GGATGGGCTGTGCCCCCATGTGG - Intergenic
920730759 1:208481819-208481841 TGATGTGCCGGGCACCCAGTGGG - Intergenic
921556162 1:216601151-216601173 GGCTGCCCCGGGCTCCCGGGCGG + Intronic
922567216 1:226608663-226608685 GGGTGGGGTGGGCTCCCAGCAGG - Exonic
922720157 1:227896184-227896206 GCATGGCCTGGGCTGCCAGGTGG + Intergenic
1062764197 10:48754-48776 GGGAGGGCCGCGTTCCCAGGAGG + Intronic
1062835830 10:635239-635261 GAATGGGGTGGGCTCCCAGCTGG + Intronic
1064552884 10:16520814-16520836 GGGTGGCCCGGGCTCTCCGGGGG + Exonic
1065879364 10:30026246-30026268 GGCCAGGCCGGGCTCCCGGGAGG - Exonic
1069720750 10:70547939-70547961 GGCTGGGGCTGGCTCCCAGATGG + Intronic
1069856655 10:71444749-71444771 GCATGTGCCAGGCTCCCAGAGGG - Intronic
1070016037 10:72532452-72532474 GCATGGGCCTGGCACACAGGAGG - Intronic
1072237601 10:93466586-93466608 TGCTGGGAAGGGCTCCCAGGAGG + Intronic
1073313226 10:102559267-102559289 GAATGGGCCTGGCTCGCAGAAGG + Intronic
1075071066 10:119320157-119320179 GGATTGGAGGGGCTGCCAGGTGG + Intronic
1075519761 10:123136480-123136502 GGACGGGGCGGGCGCGCAGGGGG - Intronic
1075667318 10:124240506-124240528 GGATGGGAAGGGTTTCCAGGTGG - Intergenic
1076293991 10:129369776-129369798 GGAGAGGCCAGGCTCCCTGGCGG - Intergenic
1076590626 10:131579899-131579921 GGCTGGGCCTGCCTTCCAGGGGG - Intergenic
1076599042 10:131645413-131645435 AGGTGGGCCGGGGTCCCTGGAGG + Intergenic
1077009277 11:372973-372995 GGGTGGGCAGGGCACGCAGGGGG + Intronic
1077174568 11:1182848-1182870 GGATGTGCTGGGCTCCGTGGGGG - Intronic
1077174783 11:1183967-1183989 GGATGTGCTGGGCTCCGTGGGGG - Intronic
1077220353 11:1412975-1412997 GGATGGGCGGGGCTCACTGCAGG + Intronic
1077367068 11:2165586-2165608 GGAGGGGACAGGCTCCCAGTGGG - Intronic
1079967262 11:26994492-26994514 GGATGGCCAGGGACCCCAGGAGG - Exonic
1081576278 11:44320176-44320198 GGCTGGGCCGCGCCCCGAGGAGG + Intergenic
1081778229 11:45691685-45691707 GGATGGGGCTGGGTCACAGGTGG - Intergenic
1083612133 11:64009391-64009413 GGATGGACGGGCCCCCCAGGGGG - Intronic
1083945219 11:65919569-65919591 GAGTGGGCCCGGCTCCCGGGTGG + Intronic
1084567811 11:69941709-69941731 GACTGGGCTGGGCTCCCTGGGGG + Intergenic
1084676164 11:70636025-70636047 GGGTGGGCCGGGCACCGGGGTGG - Intronic
1084710908 11:70843235-70843257 GGGTGGGCTGGGCTCCTATGGGG + Intronic
1084710936 11:70843315-70843337 GGGTGGGCTGGGCTCCTATGGGG + Intronic
1085011182 11:73142478-73142500 GGCCGGTCCGGGCTGCCAGGAGG + Intergenic
1085034887 11:73293755-73293777 GGAGGGGAGGGGGTCCCAGGAGG + Intronic
1089051312 11:115548598-115548620 CGCTGGGCTGGGCCCCCAGGTGG + Intergenic
1089212976 11:116819060-116819082 GGGTGGGCCGGGTTCCAAGAGGG - Intergenic
1089538605 11:119175590-119175612 GGATAGGCCTGCCTCCTAGGAGG - Intronic
1092181245 12:6448375-6448397 GGCTGGGCTGGGCTCGCTGGCGG - Intronic
1092219052 12:6700563-6700585 GGCAGGGCCGGGCTCCCCGCGGG + Intronic
1092756723 12:11770432-11770454 GGATGGGCCTGGATCACATGGGG - Intronic
1094025731 12:25958624-25958646 GGCCGGGCCGGGCGGCCAGGCGG - Intergenic
1096078389 12:48818577-48818599 GCCTGGCCCGGGCTCCCCGGTGG + Intronic
1096700620 12:53380487-53380509 GGATGGGCCGCCCGCCCCGGGGG + Intronic
1096984289 12:55745861-55745883 GGCTGGGCTTGGCTCCCAGAAGG - Intronic
1097245447 12:57605195-57605217 GGATGGGCAAGGGTCCCTGGGGG - Intronic
1098024746 12:66189552-66189574 GGAGGGGGCCGGCTCCCTGGCGG - Intronic
1098432408 12:70434225-70434247 AGATAGGGCAGGCTCCCAGGAGG - Exonic
1103280785 12:119756512-119756534 GGATGGGCCGCGGGCCAAGGAGG - Intronic
1103432994 12:120904028-120904050 GGAGAGGCCGGGCTCCGAAGCGG + Exonic
1104602748 12:130164004-130164026 GGATGGCCCAGGCTGCCAGGTGG - Exonic
1105291882 13:19058575-19058597 GTGTGGGCAGGGCTCCAAGGAGG + Intergenic
1105600877 13:21885909-21885931 AGCTGGGCCGGGCTCTGAGGAGG + Intergenic
1110703062 13:78572029-78572051 GGAAGGGAAGGGCTCCCAGTGGG - Intergenic
1113085739 13:106567899-106567921 GGATGGGCCGGTCTCGGAGCCGG - Exonic
1113942630 13:114026338-114026360 GGAGCTGCCAGGCTCCCAGGGGG - Intronic
1114551306 14:23534252-23534274 GGTTGGGCTGGGGTCCCAGGTGG + Exonic
1114570486 14:23663882-23663904 AGATGGGCAGGGCCCTCAGGTGG + Intergenic
1114656137 14:24316640-24316662 GGAAGGGCCGGGCTCCAGAGCGG - Exonic
1114696605 14:24632250-24632272 GGAAGGGCCGGCATTCCAGGGGG + Intronic
1118153393 14:63213865-63213887 GTATGGGCCAGGCTGACAGGTGG + Intronic
1118971500 14:70641904-70641926 GGAGGGGCCGGCGTCCGAGGCGG + Exonic
1119263403 14:73251237-73251259 GGATGGGGAGGGCATCCAGGCGG - Intronic
1119597374 14:75947828-75947850 GGATGCGCCAGCCTCCCATGTGG - Intronic
1120186189 14:81395995-81396017 GGCTGCTCAGGGCTCCCAGGTGG + Exonic
1121640938 14:95484384-95484406 TGAAGGGGAGGGCTCCCAGGAGG + Intergenic
1121882686 14:97514825-97514847 GGAGGGGCAGGCCTGCCAGGAGG + Intergenic
1122145135 14:99684367-99684389 GGTCGGGCCGGGCGCCGAGGGGG - Exonic
1122469348 14:101955833-101955855 GGCTGGGCCCGGCTCCGAGCGGG - Intergenic
1122575091 14:102737082-102737104 GCATGGGCTGGGGACCCAGGTGG + Intergenic
1123105891 14:105840880-105840902 CGGTGAGCCTGGCTCCCAGGTGG - Intergenic
1124350175 15:28949443-28949465 GAATAGGCACGGCTCCCAGGAGG - Intronic
1126852555 15:52805964-52805986 GGCCGGGCCAGGCTCCCGGGTGG + Intergenic
1127899842 15:63333069-63333091 GGATGGGGAGGACTTCCAGGAGG + Intronic
1128874769 15:71193084-71193106 GGATGGGCGGGGATCCTGGGGGG + Intronic
1129326046 15:74800750-74800772 AGCTGGGCCGGGCCCCCTGGGGG + Intronic
1129780229 15:78264913-78264935 GCACGGGCCGGGCTCCCGAGGGG + Intronic
1129940842 15:79495410-79495432 GGGTGGGGCAGGCTCCCTGGAGG + Intergenic
1131021590 15:89103811-89103833 AGCTGGGCAGGGCTCCCTGGAGG + Intronic
1131027324 15:89155479-89155501 TGTTGGGCAGGGCACCCAGGTGG - Exonic
1132510427 16:338243-338265 GAATGGGCTGGGGTGCCAGGCGG + Intronic
1132709773 16:1261272-1261294 GGCTGGGCTGGGCTCCCACCTGG - Intergenic
1132810656 16:1795118-1795140 GAATGTGTGGGGCTCCCAGGTGG - Intergenic
1136588353 16:31202167-31202189 GGAGGGGCCTGGATCCCAGCTGG + Exonic
1137405209 16:48183847-48183869 GCATGGGTGGGGCTGCCAGGAGG - Intronic
1137555889 16:49470181-49470203 GGATGGGCAGGCCTCGCAGGTGG + Intergenic
1137721695 16:50631262-50631284 GGGTGGGCCTGGCTGCCACGTGG + Intronic
1138445158 16:57058908-57058930 GGCTGGGCAGGGCTCCAAGGAGG + Intronic
1139419736 16:66843087-66843109 GGAGGGTCTGAGCTCCCAGGGGG + Intronic
1139776515 16:69320071-69320093 GGAAGTGCCGGGAGCCCAGGCGG + Intronic
1141054770 16:80804612-80804634 GGCCGGGCCGGGCTCCCGGGGGG - Intergenic
1141430620 16:83968794-83968816 GGCTGGGCCGGGGTCCGCGGGGG - Exonic
1141640005 16:85335505-85335527 GGGTGGGCTGGGCTCCCTGCAGG + Intergenic
1141700371 16:85639487-85639509 GGCTAGGCCTGGCGCCCAGGAGG - Intronic
1141951891 16:87344919-87344941 GGATGGGCTCTGCCCCCAGGTGG - Intronic
1141951906 16:87344954-87344976 GGATGGGCTCTGCCCCCAGGTGG - Intronic
1141951921 16:87344989-87345011 GGATGGGCTCTGCCCCCAGGTGG - Intronic
1142078188 16:88132386-88132408 GGGTGGGCTGAGCACCCAGGAGG - Intergenic
1142224952 16:88872742-88872764 GGAGGGGCCAGCCTCCCAGGAGG - Intergenic
1142353015 16:89588405-89588427 GGATGGGCGGGGCCCCCACAAGG + Intronic
1142440458 16:90094478-90094500 GGGAGGGCCGCGTTCCCAGGAGG - Intergenic
1142587072 17:980179-980201 GGAGGGGGCGGGATCCCTGGAGG - Intergenic
1142805012 17:2366956-2366978 GGATGGGCTGGCAGCCCAGGAGG - Intronic
1142978844 17:3660066-3660088 GGATTGGCTTGGATCCCAGGTGG - Intronic
1143021935 17:3921440-3921462 GGAGGGGCAGGGTCCCCAGGAGG + Intergenic
1143030501 17:3964557-3964579 GAATGGGCGGGGGACCCAGGCGG - Intergenic
1144143861 17:12378131-12378153 TGATGGGAAGGGCTCACAGGTGG - Intergenic
1144181036 17:12752818-12752840 GGATGGGCTGGACTCCGAGAAGG + Exonic
1146062889 17:29616238-29616260 GGTTGGGCAGGGCTACGAGGCGG - Intronic
1147157130 17:38549637-38549659 GGAGGGGCCAGGATCCCTGGAGG - Intronic
1147537905 17:41332887-41332909 GGATGGGCCAGGCTTGGAGGTGG - Intergenic
1147943531 17:44066719-44066741 GGTTGGGGCGGGATCCTAGGTGG + Exonic
1148625676 17:49067287-49067309 GCATGGGTCAGGCTTCCAGGTGG - Intergenic
1149633076 17:58142721-58142743 GGATGGGGCGGCCGGCCAGGCGG - Intergenic
1150246065 17:63676284-63676306 GGATGGGACTAGCTCACAGGAGG - Intronic
1150504422 17:65683538-65683560 GGAAGGACCCGGCTCCCCGGAGG + Intronic
1150656649 17:67044129-67044151 GGCTGTCCCGGGCTCCCACGGGG - Intergenic
1151665747 17:75544297-75544319 GGAGGGTCCTGGCTCCCCGGGGG - Intronic
1151858180 17:76737577-76737599 CGATCGTCCGGCCTCCCAGGCGG - Exonic
1152018685 17:77769137-77769159 GGATGTCTGGGGCTCCCAGGTGG - Intergenic
1152231049 17:79114382-79114404 GGCTGGGCGGGGCTCCAAGCAGG + Intronic
1152433317 17:80261055-80261077 GGCTGGACCGGGCACCCCGGCGG - Intronic
1152604535 17:81282540-81282562 GGCTGGGCTGGGCTCCAGGGAGG - Intronic
1152771791 17:82174249-82174271 AGCTGGCCTGGGCTCCCAGGAGG + Intronic
1152852887 17:82648148-82648170 GGCGGGGCCGGGGTCCCGGGTGG + Intronic
1152957108 18:49079-49101 GGGAGGGCCGCGTTCCCAGGAGG + Intronic
1153829873 18:8912655-8912677 GTGTGTGCCGGGCTGCCAGGAGG - Intergenic
1155451071 18:25963423-25963445 GGATTTGCCAGGCTCCCAGATGG + Intergenic
1160779879 19:872962-872984 GGTGGGGCAGGGCTCCGAGGTGG + Intronic
1160779902 19:873016-873038 GGTGGGGCAGGGCTCCGAGGTGG + Intronic
1160779909 19:873034-873056 GGTGGGGCAGGGCTCCGAGGTGG + Intronic
1160779916 19:873052-873074 GGTGGGGCAGGGCTCCGAGGTGG + Intronic
1160862703 19:1244473-1244495 GGCTGGGCAGGGATGCCAGGTGG + Exonic
1160963437 19:1734946-1734968 GGATGGGGCAGGGGCCCAGGAGG + Intergenic
1161076862 19:2290039-2290061 GGATGGGCCGGCCGCCGCGGCGG - Exonic
1161165686 19:2785905-2785927 GGATGGGTCGGGCCCCGTGGCGG + Intronic
1161321329 19:3643029-3643051 AGGTGGGCAGGGCTGCCAGGGGG - Intronic
1162548695 19:11346376-11346398 GGAGGGGGCGGGATCCCAGGGGG - Intronic
1162917553 19:13882511-13882533 GGATGGGCCCTGCTCAGAGGTGG + Exonic
1163125276 19:15241094-15241116 GGATGGGCCTGGCCACCATGTGG - Intronic
1164179576 19:22807256-22807278 CCATGGGCCGGGCTCCCCGCGGG + Intergenic
1164444018 19:28301669-28301691 GAATGGACCAGGTTCCCAGGAGG - Intergenic
1164624024 19:29714985-29715007 GGGAGGGCCGGGCTCCCGGCAGG + Exonic
1164724156 19:30453973-30453995 GGGAGGGCCGGCCTCCCATGTGG - Intronic
1164840263 19:31387875-31387897 GGCTGGGCCTGTCTCCCAGGAGG - Intergenic
1165022756 19:32937298-32937320 GGATGTGCTGGGATCCCAGTGGG - Intronic
1165356526 19:35307860-35307882 GGAAGGGCCGGGGTTCAAGGCGG + Intronic
1165914330 19:39248382-39248404 GGTGGGGCCAGGGTCCCAGGGGG + Intergenic
1167080653 19:47274563-47274585 CGAGGGGGCGGGCTCCGAGGCGG + Exonic
1167633325 19:50639238-50639260 GGGGTGGCCGGGCTCCCAGTGGG - Intronic
1167684908 19:50950133-50950155 GGTTGGGCGGGGCTCAGAGGCGG + Intronic
1168061171 19:53893094-53893116 GGCTGGGCTGGGCTCCCTTGAGG - Intronic
1168148368 19:54431723-54431745 GGGTGGGCAGGGTGCCCAGGAGG + Intronic
1168317084 19:55489112-55489134 GGATGGGCCGGGGACCCAGTGGG - Intronic
1168339853 19:55616648-55616670 GGAAGGGCCGGCCGCCCTGGTGG - Exonic
1168404836 19:56105256-56105278 GGAAGGGCAGGGCCGCCAGGTGG + Intronic
924987898 2:288137-288159 GGAGGGGCCGGGCTGGCGGGCGG - Exonic
926120536 2:10239196-10239218 GGCAAGGCAGGGCTCCCAGGTGG + Intergenic
926245520 2:11120203-11120225 GGGTGGGCAGGGCTTCCTGGGGG - Intergenic
926330951 2:11824874-11824896 TGACGCGCCAGGCTCCCAGGTGG - Exonic
927137991 2:20111419-20111441 GCCGGGGCCTGGCTCCCAGGGGG + Intergenic
927159234 2:20242408-20242430 GGGAGGGCCGGGCCGCCAGGGGG + Intergenic
927416999 2:22890249-22890271 GCATGGGCAGGGCACCCAGCAGG + Intergenic
927513860 2:23660636-23660658 GGAGGGGCTGGACTCCCAGAAGG - Intronic
927858315 2:26541176-26541198 GGAGGGGCCCTGCTCCAAGGTGG + Intronic
927879562 2:26681111-26681133 TGATGGGCTGGGACCCCAGGAGG - Intergenic
927964804 2:27262314-27262336 GGATGGGCCGGGCTCCGCGCGGG - Intronic
928904824 2:36356992-36357014 GGTAGGGCCGGGCTCCCCGAGGG - Intronic
929588463 2:43130577-43130599 GGCTGGCCTGGGCTCCCAGGAGG + Intergenic
932605527 2:73163135-73163157 AGATAGGCCTGGCTCCCAAGGGG + Intergenic
932780224 2:74554676-74554698 GGCGGGGCCGGGTTCCCTGGAGG - Exonic
932853513 2:75210638-75210660 GGCTGGGGCGGGATACCAGGGGG + Intergenic
934145520 2:89089475-89089497 GGATGGGTTGGGCTCCTATGGGG + Intergenic
934754616 2:96816520-96816542 GGAGGGGGCGGGCTGCCGGGAGG + Exonic
934769779 2:96900382-96900404 GGAAGGGACAGGCACCCAGGTGG - Intronic
935345605 2:102104820-102104842 GGAATGGCTGGCCTCCCAGGAGG - Intronic
936462559 2:112723622-112723644 GGCTGGGGTGGGCTCCCAGAAGG + Intronic
937309805 2:120895060-120895082 GGAGGGGAGGGGCTCCCCGGTGG + Intronic
937378808 2:121356962-121356984 GGCTGGGCTGGCCTCTCAGGAGG + Intronic
937537341 2:122906374-122906396 GGCTGGGCTGCGTTCCCAGGAGG - Intergenic
937692342 2:124770593-124770615 GGATGTGCAGGGCTGCCAGGTGG + Intronic
942768772 2:179489131-179489153 GCAAGGGCCGGGCTCCGAAGTGG + Intronic
944042313 2:195369358-195369380 TGATGGGCTGCGTTCCCAGGAGG - Intergenic
945178367 2:207066364-207066386 TAATTGGCCAGGCTCCCAGGTGG - Intergenic
946305594 2:218855371-218855393 TGATGTGCCAGGCTCCCAGCTGG - Intergenic
946465700 2:219910047-219910069 GGGTGGGCTGGACTCCAAGGAGG + Intergenic
948059710 2:235033761-235033783 GGATGGTCAGGGCTCCCACCCGG + Intronic
948464164 2:238144332-238144354 GTATGTGCCTGGCTGCCAGGAGG + Intronic
948679336 2:239621979-239622001 GGATGGGCCAGTATCCCTGGTGG - Intergenic
948888099 2:240893822-240893844 GGGTGGGCCTGTCTCACAGGTGG + Intronic
949041035 2:241850096-241850118 GGGTTGGCCGGGCTCCCACCAGG - Exonic
1172146674 20:32762486-32762508 GGACGGGACCGGCTCCCTGGCGG + Exonic
1172205332 20:33159212-33159234 GCACCGGCAGGGCTCCCAGGCGG + Intergenic
1172272722 20:33663612-33663634 CGCTGGGCTGGGCTCCCCGGCGG + Exonic
1173223175 20:41145977-41145999 GGATGGGCCCGGTTCCTAGGAGG - Intronic
1173788689 20:45813379-45813401 GGATGGGCCAGGCCTCCAGACGG - Intronic
1175517943 20:59580726-59580748 GGCTGGGCAAGGCTCCCTGGAGG + Intronic
1175562152 20:59939783-59939805 GCGCGGCCCGGGCTCCCAGGGGG + Exonic
1175563621 20:59954713-59954735 GGGTGGGCTGGACTCCCAGGTGG + Intergenic
1175801241 20:61802150-61802172 GCCTGGGCCTGGCTCCAAGGAGG - Intronic
1176100284 20:63361494-63361516 GGATGGACCGCGCGCCCAGGGGG + Intronic
1176254058 20:64141442-64141464 GGAGGGCCCCGGGTCCCAGGAGG + Intergenic
1176254086 20:64141506-64141528 GGAGGGCCCCGGGTCCCAGGAGG + Intergenic
1176427453 21:6557614-6557636 GGATTGGCCGGGCCTGCAGGGGG - Intergenic
1177010889 21:15729812-15729834 GGAGGGGCGGGGCTCCATGGCGG + Intergenic
1179702944 21:43165931-43165953 GGATTGGCCGGGCCTGCAGGGGG - Intergenic
1179826891 21:43971290-43971312 GGACGGGGCCGGGTCCCAGGTGG + Intronic
1181084167 22:20431673-20431695 AGATGGGGCGGGGTCCAAGGTGG - Intronic
1181440684 22:22933886-22933908 AGATGGACCAGGCTTCCAGGGGG + Intergenic
1183186682 22:36295457-36295479 GGATGGGGAGGGCAGCCAGGGGG - Intronic
1183665148 22:39242573-39242595 GGAAGGGCGGGGCCCCCGGGCGG + Intronic
1183938726 22:41280277-41280299 GGTTGGGCCAGAATCCCAGGAGG + Intronic
1184260119 22:43310170-43310192 GGATGGGCCAGGATGCCTGGAGG - Intronic
1184265223 22:43342932-43342954 GGGTGGGCCGGGGCCCCGGGAGG - Intronic
1184298376 22:43540435-43540457 GGACAGGCCGGCCTCGCAGGAGG + Intronic
1184409973 22:44320753-44320775 GGAAGGGCTGCACTCCCAGGTGG + Intergenic
1185027561 22:48424477-48424499 GGATGGGAAGGGCTCGCTGGGGG + Intergenic
1185053017 22:48563521-48563543 AGAGGGGCCTGGCTCCCAGAGGG + Intronic
1185320268 22:50197475-50197497 GGATGGGTCGGTCACCCAGGTGG - Exonic
950565476 3:13767336-13767358 GGGTGGGACTGGCCCCCAGGAGG - Intergenic
952888317 3:38025042-38025064 GGAGGGGCCAGGCTCAGAGGCGG + Intronic
953540137 3:43810916-43810938 GGATGGGCAGGCATTCCAGGTGG - Intergenic
953925942 3:46982445-46982467 AGTTGAGCCGGGCCCCCAGGGGG - Intronic
954634665 3:52065016-52065038 GGAAGGGCCTGGAGCCCAGGTGG + Intergenic
954662626 3:52234265-52234287 GGGTGGGCCAGGCTCCCCAGAGG - Intronic
959541842 3:107549047-107549069 GGATGGTCCTGTCACCCAGGTGG - Intronic
961033763 3:123628399-123628421 GGAGGGGCCTGGCTCCAGGGCGG - Intronic
961044102 3:123696956-123696978 AGAGGGGACGGGCTTCCAGGCGG - Intronic
961647760 3:128401461-128401483 TGCTGGGCAGGGCACCCAGGAGG + Intronic
967645833 3:191922518-191922540 GGATGGGGTGGGCTCCCAGGTGG + Intergenic
968134981 3:196214792-196214814 GGATGGGCCGGCCTCCAGGCAGG + Intronic
968235219 3:197027362-197027384 GCAGGGGCTGGACTCCCAGGTGG - Intronic
968512897 4:1003188-1003210 GGCCGGGCCGGGGTCCCGGGGGG + Intronic
968549109 4:1213383-1213405 ACATGGGCCTGGCTGCCAGGCGG + Intronic
968579332 4:1382743-1382765 GGATGGCCAGGCCTCCCAAGCGG - Intronic
968593778 4:1472359-1472381 GGGTGGGCCGGGGTCCCAGCTGG - Intergenic
968848110 4:3058606-3058628 TGCTGGGCCGCGTTCCCAGGAGG - Intergenic
969261839 4:6038612-6038634 TGATGGGCCTGGATCCCAGCAGG - Intronic
969310457 4:6350233-6350255 GGGAGGGCTGGGCTGCCAGGTGG - Intronic
969518001 4:7659312-7659334 TGTTGGGCCTGGCTCCCAGGAGG - Intronic
969690890 4:8703547-8703569 GGACTGGCCAGGCCCCCAGGAGG + Intergenic
969868968 4:10093189-10093211 GAATGGGGTGGGCTCCCAGAGGG - Intronic
972715261 4:41639839-41639861 GGATGGCCCAGGCTCCCACGAGG - Intronic
973697727 4:53507265-53507287 ACATGGGCTGGGCTTCCAGGGGG - Intronic
977557360 4:98499063-98499085 GGATGAGCAGGGCTGCCAGGTGG + Intronic
985441375 4:189984394-189984416 GGGAGGGCCGCGTTCCCAGGAGG + Intergenic
985688671 5:1295116-1295138 GGCTGGGCCGGGGACCCGGGAGG + Intergenic
986694255 5:10338191-10338213 AGATGGGCCAGGATCCAAGGAGG + Intergenic
988736395 5:34026234-34026256 GGTTGGGCCAGGCTCTGAGGAGG + Intronic
995457732 5:112369731-112369753 GGAAGGTAGGGGCTCCCAGGTGG - Intronic
997662787 5:135602369-135602391 GGATGGACCTGGCTTCCAGGAGG + Intergenic
997850961 5:137332178-137332200 GGAAGGGTGGGGATCCCAGGAGG - Intronic
998396188 5:141819856-141819878 AGATGGGCTGGGGCCCCAGGAGG - Intergenic
999257399 5:150217201-150217223 GGCTGGGCTGGGCTCCAAGGAGG - Intronic
1001381969 5:171311294-171311316 GGATGGCCTCGGCTCCCGGGAGG + Intronic
1001382779 5:171315125-171315147 GGATGGGGCAGGCTCCCCTGAGG + Intergenic
1001964479 5:175900723-175900745 GAATGGGGAGGGCTCCCAGGTGG + Intergenic
1002066573 5:176654853-176654875 GGATGGGCCTGGCTCACCTGGGG + Intronic
1003254240 6:4460217-4460239 AGCTGGGCCCGGGTCCCAGGAGG + Intergenic
1003399571 6:5780896-5780918 GGACAGGCCGAGCTGCCAGGAGG - Intergenic
1003498717 6:6686972-6686994 GAAGGGGCGGGGCTCCCAGCCGG - Intergenic
1006010753 6:31041114-31041136 GGAAGGGCCGGGAGCCCAGGTGG - Intergenic
1006730273 6:36231022-36231044 GGATACGCCAGGGTCCCAGGGGG + Exonic
1006796872 6:36737583-36737605 GGAAGGCCAGGGCTCCCAGCAGG - Intergenic
1007236124 6:40392390-40392412 GGCTGGGACGGGCCCCCTGGAGG - Exonic
1007764522 6:44152797-44152819 CGAGGGGCCGGTCTCCCAGCCGG - Intronic
1007833461 6:44656165-44656187 AGAAGGGCCTGGCTTCCAGGGGG - Intergenic
1013117458 6:107114412-107114434 GGATGGGCCCCGCCGCCAGGGGG - Exonic
1019448247 7:1082516-1082538 GGCTGGGACGGGCTCACAGGAGG + Intronic
1019729390 7:2622114-2622136 GGATGGGAAGGGCCCCAAGGTGG + Intergenic
1020006306 7:4785288-4785310 GGGTGGGACAGGCCCCCAGGAGG - Intronic
1020011073 7:4805974-4805996 GCAAGGGCCGGCCTCACAGGCGG + Intronic
1022427709 7:30284706-30284728 GGAGGGGCCGGGCTGGCGGGAGG - Exonic
1024144042 7:46492994-46493016 GGATAGGTCGGGCTCTCAGGTGG + Intergenic
1025212121 7:57025797-57025819 GGACGGGCTGGGCTCCCTGCAGG + Intergenic
1025659833 7:63551031-63551053 GGACGGGCTGGGCTCCCTGCAGG - Intergenic
1026621267 7:71951953-71951975 GGTTGGGTCTGACTCCCAGGAGG - Intronic
1026665220 7:72336014-72336036 GGATGGGTCTGGCGCCCAGGTGG - Intronic
1026880064 7:73902207-73902229 GGCTTGGCTGGGCGCCCAGGTGG + Intergenic
1029514694 7:101017874-101017896 GGAAGGGAAGGGGTCCCAGGGGG - Intronic
1029514715 7:101017915-101017937 GGAAGGGAAGGGGTCCCAGGGGG - Intronic
1029514736 7:101017956-101017978 GGAAGGGAAGGGGTCCCAGGGGG - Intronic
1029514757 7:101017997-101018019 GGAAGGGAAGGGGTCCCAGGGGG - Intronic
1029514778 7:101018038-101018060 GGAAGGGAAGGGGTCCCAGGGGG - Intronic
1029514843 7:101018162-101018184 GGAAGGGAAGGGGTCCCAGGGGG - Intronic
1029514864 7:101018203-101018225 GGAAGGGAAGGGGTCCCAGGGGG - Intronic
1029675297 7:102064552-102064574 GGATGGGCTGAGCTCCCTGCAGG + Intronic
1034219333 7:149431958-149431980 GGATGCGCCGGTGTTCCAGGAGG + Exonic
1035459948 7:159032399-159032421 GGATGGGCCGGGCTCCCAGGCGG - Intronic
1036033249 8:4994126-4994148 GGGTGGGGCGGGGGCCCAGGAGG + Intronic
1037389781 8:18381104-18381126 GGATGGGCTTGGCTGCCATGAGG + Intergenic
1038807901 8:30812159-30812181 CGATGGGCCGGCCGCCTAGGTGG + Intronic
1039884728 8:41648423-41648445 GGATGGGCAGGGCTCCGAGAGGG + Intronic
1044392910 8:91673446-91673468 TGAAGGGCAGGGCTCCAAGGAGG - Intergenic
1045112444 8:98948029-98948051 AGATGGTTCAGGCTCCCAGGGGG - Intronic
1045318409 8:101063084-101063106 GGGTGGGGCGCCCTCCCAGGAGG - Intergenic
1048982839 8:139712301-139712323 GGATGTGCCTGGCTCACAGCAGG + Intergenic
1049075867 8:140395868-140395890 GGTCAGGCCGGGCTCCGAGGAGG - Intronic
1049349975 8:142159231-142159253 AAATGGGCCGGGCTCCCAGGTGG + Intergenic
1049350221 8:142160423-142160445 AAATGGGCCGGACTCCCAGATGG - Intergenic
1049407326 8:142457557-142457579 GGGTGGGCAGGGCTGCCAGCAGG - Intronic
1049454658 8:142680815-142680837 GGCAGGGCCTGGCTCCTAGGGGG + Intronic
1049583624 8:143423332-143423354 GGCTGAGCCTGGCTCCTAGGGGG - Intronic
1049595710 8:143482374-143482396 GGATGTGCCGGGCACGCAGGGGG + Intronic
1049775440 8:144401767-144401789 GTTTGGGCAGAGCTCCCAGGAGG - Intronic
1052130995 9:24846445-24846467 GGCTGGGCAGGGCTCCAAGAGGG + Intergenic
1055420504 9:76136134-76136156 GAATGGGCTGGGCTCCCAGTGGG + Intronic
1057054173 9:91949062-91949084 GGCGGGGCCCGGCTCCTAGGTGG - Intronic
1057856994 9:98609600-98609622 TGAAGGGCAGGGCTCCAAGGTGG + Intronic
1060675156 9:125507419-125507441 GGCCGTGCAGGGCTCCCAGGCGG + Intronic
1060700688 9:125747195-125747217 GGAAGCGCCGGGCTCCGCGGCGG - Intergenic
1062012738 9:134275698-134275720 CCAAGGGCCGGGCACCCAGGAGG + Intergenic
1062321496 9:135992594-135992616 TGGTTGGCCCGGCTCCCAGGTGG + Intergenic
1062344491 9:136108628-136108650 GGCTGGGCCCGGGTCCCAGTGGG - Intergenic
1062360727 9:136186694-136186716 GGAGAGGCCGTGCTCCCACGAGG - Intergenic
1062361647 9:136191047-136191069 GGATGAGCCTGCCTCCCAGTGGG - Intergenic
1062382755 9:136295279-136295301 GGAGGGGCCGGGCGGGCAGGCGG - Intronic
1062467819 9:136688875-136688897 GTGTGGGCTGGGGTCCCAGGTGG + Intergenic
1062741059 9:138175550-138175572 GGGAGGGCCGCGTTCCCAGGAGG - Intergenic
1192214670 X:69150186-69150208 GGAGGGGCGGGGCTCCGAGGAGG + Intergenic
1192224911 X:69221577-69221599 GGAGGGGCGGGGCTCCGAGGAGG - Intergenic
1195797342 X:108665545-108665567 GGAAGGCCGGGGTTCCCAGGAGG - Exonic
1197774593 X:130110922-130110944 GGATGGGGCGGGCGCGAAGGAGG + Intergenic
1199844423 X:151680473-151680495 GCATGGGCTGGGCTTACAGGAGG + Intergenic
1200054935 X:153455383-153455405 GGCTGGGCTGGGCTCCCTGCTGG - Intronic
1200228587 X:154432775-154432797 GGGTGGGATGGGCTTCCAGGAGG + Intronic
1200236326 X:154469514-154469536 GCAGGGTCCTGGCTCCCAGGTGG - Intronic
1201283824 Y:12362635-12362657 GGCAGGGCCGGGCTCCCTCGGGG + Intergenic