ID: 1035461528

View in Genome Browser
Species Human (GRCh38)
Location 7:159041950-159041972
Sequence GCCCAACTCCACCTGGGGAA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 1, 2: 0, 3: 20, 4: 204}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035461519_1035461528 5 Left 1035461519 7:159041922-159041944 CCCTATTACTAGGACAGGAACTC 0: 1
1: 0
2: 0
3: 11
4: 93
Right 1035461528 7:159041950-159041972 GCCCAACTCCACCTGGGGAACGG 0: 1
1: 1
2: 0
3: 20
4: 204
1035461520_1035461528 4 Left 1035461520 7:159041923-159041945 CCTATTACTAGGACAGGAACTCC 0: 1
1: 0
2: 0
3: 4
4: 85
Right 1035461528 7:159041950-159041972 GCCCAACTCCACCTGGGGAACGG 0: 1
1: 1
2: 0
3: 20
4: 204
1035461516_1035461528 28 Left 1035461516 7:159041899-159041921 CCACTGTTACACATGTGGGGAGA 0: 1
1: 0
2: 2
3: 14
4: 136
Right 1035461528 7:159041950-159041972 GCCCAACTCCACCTGGGGAACGG 0: 1
1: 1
2: 0
3: 20
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035461528 Original CRISPR GCCCAACTCCACCTGGGGAA CGG Intronic
900811509 1:4805117-4805139 GCCCAACCCCAACTGTGAAAAGG + Intergenic
900931567 1:5741298-5741320 GCCCAGCTCCACCTGGAGCCAGG + Intergenic
901237196 1:7673448-7673470 TCCGAACTCCCCCTTGGGAAAGG - Intronic
901657950 1:10781344-10781366 GGCCACCTGCTCCTGGGGAAGGG + Intronic
902218459 1:14949670-14949692 GCCCCACTTCACCTGAGGATTGG - Intronic
902272413 1:15314329-15314351 CCCCAACTGGAGCTGGGGAAAGG + Intronic
903326179 1:22569839-22569861 GCCCCCATCCTCCTGGGGAAGGG + Intronic
903344761 1:22677149-22677171 GCCCATCTGCTCCTGGGGAGCGG + Intergenic
903983042 1:27203706-27203728 GACCCACTGCACCTGGGGGAAGG - Intergenic
904145130 1:28384604-28384626 ACCCAACTCCACCAGGCGCAAGG + Intronic
904823372 1:33258942-33258964 ACCAAAGTCCACCTGGGAAAAGG - Intronic
905205160 1:36339248-36339270 GCTGAACTCCATCTGGGGTAGGG - Intergenic
906063866 1:42966092-42966114 GCCCAGCTCCACCTTGTGATTGG + Intergenic
906073593 1:43035714-43035736 GCCCAACTCAAGCTGGGGTCAGG - Intergenic
907056808 1:51376894-51376916 GCCCAAATCCATCAGAGGAATGG - Intronic
907441397 1:54480693-54480715 CCCCACCCCCAGCTGGGGAAGGG - Intergenic
907877653 1:58508822-58508844 GCCCAGCTTCTCCTGGGGCAGGG + Intronic
910278758 1:85475488-85475510 GCCCAACTTCCCCTGCTGAATGG + Intronic
912853325 1:113145761-113145783 GCCCAAGGCCACATGGGCAAGGG + Intergenic
915467664 1:156106695-156106717 GCCCCTCACCACCTGGGGGAAGG - Intronic
1063187815 10:3666355-3666377 GACCACCTCCACGGGGGGAACGG - Intergenic
1064520015 10:16191021-16191043 ACCCAATTCCACCTGGGGTAGGG + Intergenic
1064565306 10:16633438-16633460 ACCCATCCCCACCTGGGGAGAGG + Intronic
1068188604 10:53619844-53619866 GCCCACATCCACTGGGGGAATGG - Intergenic
1069346206 10:67472913-67472935 GATCAACTCCATTTGGGGAAAGG - Intronic
1071156252 10:82692658-82692680 GCCCACCTGTACTTGGGGAATGG - Intronic
1072565879 10:96616175-96616197 GCCCTGCTACACCTGGGGCATGG + Intronic
1073350430 10:102815779-102815801 TCCCCACTCTAACTGGGGAAAGG - Exonic
1075390551 10:122087848-122087870 GCCCCATTCCAGCTGGGGATGGG + Exonic
1075463270 10:122632595-122632617 TCCCCACTCCATCTGGGGCAGGG + Intronic
1076469746 10:130710180-130710202 CCTCAACCCCACCTGGGGAGGGG - Intergenic
1076561814 10:131371864-131371886 AGGCAACACCACCTGGGGAAAGG - Intergenic
1076719709 10:132387695-132387717 TCCCAAATCCACCAGGGGAGGGG - Intergenic
1077388347 11:2286434-2286456 TCCAAACTCCACCAGGGCAAGGG + Intergenic
1077494915 11:2882264-2882286 TCCCACCTCCACCGGGGGCAGGG - Intergenic
1078014241 11:7599536-7599558 GCCCAGCACCACCTGGGGAGAGG + Intronic
1079346825 11:19660116-19660138 GCCAAACTCTTGCTGGGGAAGGG - Intronic
1080789852 11:35512583-35512605 GCCCAAGGCCACCTGGGAACTGG - Intronic
1083573245 11:63771081-63771103 CCCCAACCCCACTGGGGGAAGGG + Intergenic
1083621760 11:64052816-64052838 GCAGAACCCCACCTGGGCAAAGG - Intronic
1083927179 11:65815064-65815086 GGCCAAGTCAACCTGGGGAAGGG - Intergenic
1085426420 11:76408700-76408722 GGCCATCTCCATCTGGGGGATGG + Intronic
1088469388 11:110177174-110177196 TCCCACCTCCACCCGGGGACAGG + Intronic
1089336120 11:117725165-117725187 GCCCAGCTATGCCTGGGGAAGGG - Intronic
1089340154 11:117751811-117751833 GCTCAACTCCACTTGGGAGAGGG - Intronic
1089508369 11:118979807-118979829 GCACAAATGCACCTGGGAAAAGG - Intronic
1090405745 11:126474994-126475016 GCCCAGCTCCTCCTGGGGTAAGG - Intronic
1091442990 12:526130-526152 TCCTAACTGCACCTAGGGAAGGG + Intronic
1092113720 12:5983144-5983166 ACCCAACTTCACCTGCGGTAAGG - Exonic
1093857895 12:24127760-24127782 ACCTCACCCCACCTGGGGAAGGG + Intergenic
1095524407 12:43108278-43108300 GCCCAACTCCACCATGCCAATGG - Intergenic
1100235849 12:92660187-92660209 GACCAACTCCACCTGTTGATGGG - Intergenic
1100403935 12:94256530-94256552 GCAGAACACCGCCTGGGGAAAGG + Intronic
1102277939 12:111598046-111598068 ACCCTCCCCCACCTGGGGAAGGG - Intronic
1103613038 12:122135591-122135613 GCGCAAGACCCCCTGGGGAAGGG + Exonic
1103675580 12:122653127-122653149 GCTCTACTCCACATGGAGAAAGG - Intergenic
1104749090 12:131227191-131227213 GCCCATCCCCTCCTGGGGAGAGG + Intergenic
1106904649 13:34392239-34392261 ACCCCACTCTACCTGCGGAAGGG - Intergenic
1111344531 13:86933319-86933341 TCCCCACTCTAACTGGGGAAAGG + Intergenic
1113579535 13:111419275-111419297 GCCCAAATCAACCTGGGGTGGGG + Intergenic
1113610624 13:111642399-111642421 TCCCAGCTCCACCTGAGGAAAGG - Intronic
1114051450 14:18921926-18921948 GCCCAGCCCGACCTGGGGATGGG + Intergenic
1114111111 14:19479998-19480020 GCCCAGCCCGACCTGGGGATGGG - Intergenic
1114492876 14:23114185-23114207 GCCAAACCCTGCCTGGGGAAAGG - Intergenic
1115641324 14:35337308-35337330 AACCAGCTCCACCTAGGGAAAGG + Intergenic
1116997301 14:51337018-51337040 TCCCAACTCCACCTTGAGAGTGG + Intergenic
1117647419 14:57866204-57866226 CCCCAACCCCACCTGATGAAAGG + Intronic
1119436179 14:74599403-74599425 ACCCCACCCCAACTGGGGAAGGG - Intronic
1121017458 14:90557144-90557166 GCCCCACCCCACCTGAGGACAGG - Intronic
1121100460 14:91246491-91246513 GCCCTACTGCACCTGGAGTAAGG + Intronic
1126702498 15:51380744-51380766 GCCACACCCCACCTGGGGAGAGG - Intronic
1128172522 15:65525503-65525525 TCCCAACTCTGCCTGGAGAATGG - Intergenic
1129701204 15:77769552-77769574 GCCCAGCTCAACCTGGGGTATGG - Intronic
1129717306 15:77859889-77859911 GTCCAGCTGCACCAGGGGAAGGG + Intergenic
1130799333 15:87245288-87245310 CTCCAACTCCCCCTGGGGTAAGG - Intergenic
1131719377 15:95150588-95150610 ACCCCACTCCACTTGGAGAAAGG + Intergenic
1132145607 15:99427480-99427502 GCCAAACTCCATCCGGGGAGAGG - Intergenic
1132765389 16:1531843-1531865 TCCCCACTCAACCTGAGGAAAGG + Intronic
1132947078 16:2537788-2537810 GCCCGACCCCGCCTGGGGAGGGG - Intergenic
1133173980 16:3999741-3999763 GCCCACGTCCACATGGGGGAAGG - Intronic
1133201720 16:4207833-4207855 AGTCACCTCCACCTGGGGAAAGG - Intronic
1136268031 16:29132205-29132227 GCACTACTTCTCCTGGGGAATGG - Intergenic
1138726875 16:59149865-59149887 GTCCAGCTCCACTTGGGGATTGG + Intergenic
1139146611 16:64332442-64332464 TCCCAGCTTCACCTAGGGAAGGG - Intergenic
1141685135 16:85565827-85565849 ACCCAACTCCTCCTGGAGCATGG - Intergenic
1142475253 17:184929-184951 GCCCACCTCAGCATGGGGAATGG - Intergenic
1142678781 17:1533126-1533148 TGCCAACCCCACCTGGGGCAAGG + Intronic
1142702861 17:1674781-1674803 GCACAACTCCGCCTCGGGAGTGG - Intronic
1143107623 17:4537442-4537464 TCCCAATGGCACCTGGGGAAAGG - Exonic
1143718823 17:8796164-8796186 CCCAAACTCCCCCAGGGGAAGGG - Intergenic
1144770955 17:17759172-17759194 GTCCATCCCCACATGGGGAAGGG + Intronic
1145118706 17:20236139-20236161 GCCCCCCTCCACCTGGGAGAGGG - Intronic
1146103802 17:30012220-30012242 TCCAAACTCCCCCTGGGAAAGGG - Intronic
1147958673 17:44152841-44152863 GCCCTACTCCACCTTAGGAAGGG + Intronic
1148647768 17:49229204-49229226 GCCAAATTCCAACTGGGGAAGGG - Intronic
1148690533 17:49524567-49524589 GCCCAAGGCCACCTGAGTAAGGG + Intergenic
1149127493 17:53254020-53254042 TCCCAACAACTCCTGGGGAAGGG + Intergenic
1149460901 17:56829503-56829525 ACCCAAGCCCTCCTGGGGAAGGG - Intronic
1150208488 17:63427797-63427819 GCCCAATTCCTCCTGAGGGAGGG - Intergenic
1151365101 17:73611911-73611933 GCCCAACTCTGCGTGGGGAAGGG + Intronic
1151984190 17:77531527-77531549 GCCTAACTCCTCCTGGGGCCTGG + Intergenic
1156464752 18:37341696-37341718 GCCCAACTCCACCCCAGGCAGGG - Intronic
1159025570 18:63179621-63179643 TCCCAACTCCACCTAGGGGAGGG + Intronic
1159960877 18:74555077-74555099 GCTCACCTCCACCTACGGAAAGG + Intronic
1160806754 19:995314-995336 GTCCAACTCCCTCTGGGGACCGG - Intronic
1160907186 19:1456842-1456864 GACCACCTCCACCTGGGGGGAGG - Exonic
1161681302 19:5681096-5681118 GCCCACCTCCTCCCGGGGAGGGG - Exonic
1162823617 19:13237791-13237813 ACCCAGCTCCACCTGGGGATGGG + Intronic
1162895236 19:13761492-13761514 GGCCAGCTCCACCAGGGCAAGGG + Intronic
1164804334 19:31104637-31104659 GCCAAACTCCACCTGCTGAAGGG - Intergenic
1166841334 19:45698923-45698945 GCCCCAGCCCACCTGGGGTATGG + Intronic
1168076107 19:53981742-53981764 GCCCTACACCACCTGGGGGATGG + Intronic
1168301182 19:55406116-55406138 GCCCAGCTCCACCTGCCCAAGGG + Intronic
925243165 2:2352127-2352149 GCGCCACTGCACCTGGGCAACGG + Intergenic
926541096 2:14182541-14182563 GCCCAGCTCCACCTTGGGCCTGG - Intergenic
926918105 2:17912642-17912664 GACAACCTCCCCCTGGGGAATGG - Intronic
927885290 2:26714481-26714503 GCCCAACTGCTGCTGGGGAGGGG + Intronic
928378927 2:30801809-30801831 GACAAAGTCCACCAGGGGAAGGG + Intronic
929945370 2:46367541-46367563 GCCCAAGTACACCTTGGCAAAGG - Intronic
931197677 2:60068213-60068235 CCACATCTCCACCTGGGGTAGGG + Intergenic
932337311 2:70938524-70938546 GCCCACCTCCCCCGGGGGAGGGG - Intronic
932356565 2:71072630-71072652 GCACAACTCCACCTGGGGAAAGG - Exonic
932668979 2:73720262-73720284 CCGCATCTGCACCTGGGGAAAGG - Intergenic
934517290 2:94996695-94996717 GCCGACCTCCAGCTGGGGAGAGG + Intergenic
936022543 2:109005870-109005892 GCCCAGTTCAGCCTGGGGAATGG + Intergenic
936450501 2:112630439-112630461 CACCAACTCCAGCTGCGGAAGGG - Intergenic
941709138 2:168693426-168693448 CCACATCACCACCTGGGGAAAGG - Intronic
942547309 2:177078599-177078621 GCCCATCTTGGCCTGGGGAAGGG - Intergenic
942851742 2:180495312-180495334 GCCCAATTCAACCTGAGGATGGG + Intergenic
943233747 2:185291361-185291383 CTCTAACTCCCCCTGGGGAAAGG - Intergenic
945668342 2:212770356-212770378 CCCCAACTCCACCTGAGGGAGGG - Intergenic
948608992 2:239155086-239155108 GACCCACTCCACCTGGGACATGG + Intronic
948609011 2:239155156-239155178 GACCCACTCCACCTGGGACATGG + Intronic
948609078 2:239155416-239155438 GGCCCACTCCACCTGGGACATGG + Intronic
948609085 2:239155437-239155459 GGCCCACTCCACCTGGGACATGG + Intronic
948613788 2:239185387-239185409 GCCCCACGCCTCCTGGGGAGAGG + Intronic
1169217934 20:3804136-3804158 ACCCACCTCCACCTGGGCACCGG + Intronic
1170945939 20:20891111-20891133 ACCCAGCTCCCCCTGGGGCAGGG + Intergenic
1172022719 20:31925677-31925699 ATCCCCCTCCACCTGGGGAAAGG + Intronic
1173507485 20:43599332-43599354 ACCCATCTCCACTTGGGAAAAGG - Intronic
1173579549 20:44137409-44137431 GCCGAGCCCCACCTGGGGAGGGG - Intronic
1174264013 20:49318580-49318602 GCCCAGGTGCACCCGGGGAAAGG + Intergenic
1175032350 20:55968483-55968505 ACCCAACTCCAACTGATGAATGG - Intergenic
1175916118 20:62426880-62426902 GCCCACCTCCACCTCCGGGAGGG - Intronic
1176061807 20:63175819-63175841 GACCGGCTCCACCTGGGGCAGGG - Intergenic
1180469923 22:15644302-15644324 GCCCAGCCCGACCTGGGGATGGG + Intergenic
1181624273 22:24112774-24112796 GACCCACTGCAGCTGGGGAAGGG - Intronic
1181712187 22:24697593-24697615 GCCCAAGACCACTTTGGGAAAGG + Intergenic
953634634 3:44652391-44652413 GCCCAACTCACCCTGGGGGTTGG + Intronic
954363440 3:50134294-50134316 AGTCCACTCCACCTGGGGAAGGG + Intergenic
954801522 3:53189747-53189769 GCCCCAGTCAGCCTGGGGAACGG - Intronic
963068352 3:141281635-141281657 GCCTGACCCCACCTGGGGCAGGG + Intronic
963837707 3:150073845-150073867 GCCCACCTCCTCCTGGGCTATGG + Intergenic
967031788 3:185614609-185614631 GCCCGACTCCGCCTGGGCAGTGG + Exonic
968233185 3:197016132-197016154 GCCCAGCTCAACCTCGGGCATGG - Intronic
969601948 4:8181972-8181994 GCCCCACCCCACCCTGGGAAGGG - Intergenic
969987053 4:11223341-11223363 CCCCAACCCCTGCTGGGGAAGGG - Intergenic
971666543 4:29493795-29493817 GCCCAACCCCAGCTGCTGAATGG - Intergenic
975732403 4:77350479-77350501 GCCCAACACTCCCTGGAGAAGGG - Intronic
977908415 4:102502107-102502129 CCCCAGCCCCACCTGGGGGATGG + Intronic
980494691 4:133575633-133575655 GCCCAACTGGGCCTTGGGAAAGG + Intergenic
982763416 4:159315973-159315995 TCTAAACTCCCCCTGGGGAAGGG + Intronic
988972900 5:36487674-36487696 TCCCCATTCCAGCTGGGGAAAGG + Intergenic
991934243 5:71786042-71786064 AGCCACCTCCACCTGGGGACTGG - Intergenic
992603752 5:78433951-78433973 GACCCACTGCAGCTGGGGAAAGG - Intronic
997475414 5:134139641-134139663 GCCCAACTCCAGCTGAGGACAGG - Intronic
997593041 5:135087196-135087218 GACCAGCCCCACCTGGGCAAAGG + Intronic
998097231 5:139402978-139403000 CCCCAACCCAGCCTGGGGAAGGG + Intronic
999227613 5:150040051-150040073 ACACAACTTCACCTGGGGAAAGG - Intronic
1006915247 6:37589742-37589764 GCCCACCTCCACGTGAGGAGGGG - Intergenic
1008881853 6:56388001-56388023 GACTACCTCCACTTGGGGAAAGG + Intronic
1013424541 6:109998969-109998991 CCCCAACTCCACACAGGGAAGGG + Intergenic
1014905041 6:127015657-127015679 GCCTGAATCCTCCTGGGGAATGG + Intergenic
1014955831 6:127614774-127614796 GCCCTACTTCATCTGGGAAAAGG + Intergenic
1015578943 6:134702525-134702547 GCCCAGCTGCTGCTGGGGAATGG + Intergenic
1015695595 6:135976424-135976446 CCACACCTCTACCTGGGGAAGGG + Intronic
1015787119 6:136929680-136929702 GCCTTATCCCACCTGGGGAAAGG - Intergenic
1019117145 6:169774410-169774432 GCCCACCTCCACCTTCGTAAGGG - Intronic
1019365571 7:630832-630854 GCCCTGCTCCACCTGGGTGATGG - Intronic
1020013350 7:4818004-4818026 TCCCATCAGCACCTGGGGAAGGG + Intronic
1020404318 7:7814799-7814821 GCCATACTCCACCTGAGGCATGG - Intronic
1022469350 7:30672680-30672702 GTCCAACCCCACATGGGGGAGGG + Intronic
1022514816 7:30968920-30968942 GCCCAACACCACCCTGGGTATGG + Exonic
1023033526 7:36110789-36110811 GGCCAACTTCACCTTGGCAAAGG + Intergenic
1023055091 7:36284626-36284648 CCCTAGCGCCACCTGGGGAAAGG - Intronic
1024376304 7:48642578-48642600 GCCCAACACCACCTGAGATAAGG + Intronic
1024534412 7:50418307-50418329 GCCCAGCTCCTCGTGGGGAGAGG + Intergenic
1024602389 7:50995233-50995255 GCCCATGTTCACCTGGGGATGGG + Intergenic
1026845396 7:73696273-73696295 TCCCAGCTCCCCATGGGGAATGG - Intronic
1028347370 7:89798945-89798967 CCCCAACAACTCCTGGGGAAGGG - Intergenic
1028822250 7:95225905-95225927 ACTCACCTCCACCTGGGGTAAGG + Intronic
1029669547 7:102019684-102019706 GTACAACTCCACCACGGGAAGGG - Intronic
1030267123 7:107632003-107632025 TCCCCACTCTAACTGGGGAAAGG - Intergenic
1032051628 7:128653831-128653853 TCCCAGCTCCAGCTGGAGAAGGG - Intergenic
1033156298 7:138960033-138960055 GCCCAACTCCAATTGGTCAAAGG + Intronic
1033284228 7:140026786-140026808 CCCCAACCCCATCTGGGGACAGG + Intronic
1035461528 7:159041950-159041972 GCCCAACTCCACCTGGGGAACGG + Intronic
1037810038 8:22081567-22081589 CCCCCACTCTACCTGAGGAAAGG - Exonic
1040408500 8:47132825-47132847 GCCCACGCCCACCTGGGGAAAGG + Intergenic
1045663811 8:104465845-104465867 GCCTACCTTCACCTGGGGAGTGG + Intronic
1045785452 8:105915908-105915930 GCCCAACTCCAAATGGGGCTTGG - Intergenic
1047625627 8:126653163-126653185 GCCCAGCTGCACCTGGAGGATGG - Intergenic
1047959592 8:130001266-130001288 GCCCAACTTCTCTTGGGGAGAGG - Intronic
1051607312 9:18928385-18928407 GGGCAAGTCCAGCTGGGGAACGG + Exonic
1055532127 9:77194684-77194706 CCCCAAATGCTCCTGGGGAAAGG - Intronic
1057844796 9:98515083-98515105 GCTCAGTCCCACCTGGGGAAGGG - Intronic
1059399606 9:114060748-114060770 GCCCAATTCCAGCTGGGGTAAGG + Intronic
1060390690 9:123274186-123274208 GCCCACCTTCAGCTGGGGCAGGG - Intergenic
1061250765 9:129425013-129425035 GCCCACCTCCAGCTGGCCAACGG + Intergenic
1062100383 9:134724935-134724957 GCCCAACCCCATCTGGAGGATGG - Intronic
1062538022 9:137029356-137029378 GCCCACCCCTACCTGGGGTAGGG + Intronic
1062686537 9:137816549-137816571 GACCAAGCCCAGCTGGGGAAGGG - Intronic
1186845706 X:13528923-13528945 ATCCAGCTCCACCTGGAGAAGGG + Intergenic
1190454898 X:50617875-50617897 GACCAACTCCAGAAGGGGAAGGG + Intronic
1191863019 X:65681363-65681385 AACCACCTCCACCTGGAGAATGG - Intronic
1192196799 X:69034049-69034071 GCCTAACTCCACCTCAGAAAAGG + Intergenic
1195270040 X:103220357-103220379 CCCCAACTACTCCTGGGGAAGGG + Intergenic
1195521511 X:105835645-105835667 GACCTACTGCAGCTGGGGAAAGG - Intronic
1197093826 X:122571306-122571328 CCCCAACGACTCCTGGGGAAGGG + Intergenic
1198759090 X:140012255-140012277 CCCCAACAACTCCTGGGGAAGGG - Intergenic
1198779653 X:140221317-140221339 CCCCAACAACTCCTGGGGAAGGG + Intergenic
1198937793 X:141916913-141916935 GGCCAACTGCCCCTGGGAAACGG + Intergenic
1198961258 X:142185951-142185973 GGCCAACTGCCCCTGGGAAACGG - Intergenic
1199627583 X:149755015-149755037 TCCCAACACCTACTGGGGAATGG + Intergenic
1200117153 X:153774409-153774431 GCCCATCTGCACCTGGGGGGCGG - Exonic
1201901397 Y:19048341-19048363 TCCCAAGGCCACCTGGGGAAGGG - Intergenic