ID: 1035466835

View in Genome Browser
Species Human (GRCh38)
Location 7:159084779-159084801
Sequence CCGCCAGTTGCCAGTCTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 85}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035466832_1035466835 -10 Left 1035466832 7:159084766-159084788 CCCTCACTGGAGGCCGCCAGTTG 0: 1
1: 0
2: 0
3: 7
4: 100
Right 1035466835 7:159084779-159084801 CCGCCAGTTGCCAGTCTCAGAGG 0: 1
1: 0
2: 1
3: 8
4: 85
1035466831_1035466835 -9 Left 1035466831 7:159084765-159084787 CCCCTCACTGGAGGCCGCCAGTT 0: 1
1: 0
2: 1
3: 11
4: 110
Right 1035466835 7:159084779-159084801 CCGCCAGTTGCCAGTCTCAGAGG 0: 1
1: 0
2: 1
3: 8
4: 85
1035466830_1035466835 -6 Left 1035466830 7:159084762-159084784 CCACCCCTCACTGGAGGCCGCCA 0: 1
1: 0
2: 1
3: 18
4: 212
Right 1035466835 7:159084779-159084801 CCGCCAGTTGCCAGTCTCAGAGG 0: 1
1: 0
2: 1
3: 8
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035466835 Original CRISPR CCGCCAGTTGCCAGTCTCAG AGG Intronic
900515874 1:3082046-3082068 CCGCCAGCCTCCAGCCTCAGAGG + Intronic
902374782 1:16025266-16025288 CAGCCATCTGCCAGTCCCAGTGG + Intronic
902424386 1:16308329-16308351 CAGCCTTTTGCCAGGCTCAGTGG + Intronic
907212878 1:52838371-52838393 CAGCAAGTTGCCAGGCGCAGTGG - Intergenic
910657350 1:89632779-89632801 CCGCCAGGTGGGCGTCTCAGGGG + Intergenic
919751222 1:201039505-201039527 AGGCCAGTTGCCAGTGTCACAGG + Exonic
1070416349 10:76193433-76193455 CCACCAGTTGTTAGCCTCAGAGG - Intronic
1070528666 10:77317122-77317144 CTGGCAGTTGGCAGTCTAAGTGG - Intronic
1072464475 10:95650472-95650494 CAGCCTGGTGCCAGTCTCAGAGG + Intronic
1075871766 10:125776101-125776123 CCTCCAGTTGCCAGTGCCTGTGG + Intergenic
1080399142 11:31917931-31917953 GCTCCAGTCGCCAGTCCCAGTGG - Intronic
1081041835 11:38223256-38223278 CCTCTAGTTGTCAGTTTCAGCGG - Intergenic
1083616584 11:64029317-64029339 CCGCCAGATGCCTGTTTCAGGGG - Intronic
1085676716 11:78527820-78527842 CCCCCAGAGGCCAGGCTCAGTGG + Intronic
1088065113 11:105708076-105708098 CCATCAGTTACCAGTTTCAGTGG + Intronic
1091357364 11:134947757-134947779 CCGCCAGTTCCCAGGCCCCGTGG + Intergenic
1091396261 12:155802-155824 CCGGCAGTGGGCAGTGTCAGGGG + Intronic
1092187837 12:6493983-6494005 CCGCGCGTTGCCAGACTCAGAGG + Exonic
1113780323 13:112973015-112973037 CCCCCAGTTGCAGGTCTCAGAGG + Intronic
1118460375 14:65981668-65981690 CTGCCAGCTCCCTGTCTCAGCGG - Intronic
1119205161 14:72788587-72788609 CTGCCAGTTGCCAGACACACAGG + Intronic
1119585708 14:75832971-75832993 CATCCAGTTCCCAGTTTCAGCGG + Intronic
1121001852 14:90456748-90456770 CCTGCAGATGCCAGCCTCAGAGG - Intergenic
1121327837 14:93031821-93031843 CTGCCAGTTGCCATTCTAGGGGG - Intronic
1122616085 14:103019025-103019047 CCTCCACTTCCCAGGCTCAGGGG + Intronic
1124587813 15:31025656-31025678 CTCCCAGTTCCCACTCTCAGGGG + Intronic
1134018996 16:10908379-10908401 CCGCCATGTGCCAGTCACTGGGG + Intronic
1136046912 16:27622375-27622397 CTGCCAGCTGCCTGTCCCAGTGG + Intronic
1136291407 16:29274503-29274525 CCCCCAGCTGCCAGGCACAGTGG + Intergenic
1138658092 16:58502092-58502114 CTGCCAGGTGCCAGTCTCAGGGG - Intronic
1144916457 17:18727518-18727540 CCGCCAGGTGTCGGTGTCAGAGG + Exonic
1145990707 17:29077808-29077830 CTGCCAGTTGCCAGTCAGTGTGG + Exonic
1147561860 17:41514217-41514239 TGGCCAGTGGCCATTCTCAGGGG - Intronic
1151767563 17:76140188-76140210 CCACCAGGTGCCAGGTTCAGCGG - Exonic
1152245942 17:79184604-79184626 CTGCCAGTGGCCACTGTCAGAGG + Intronic
1164562021 19:29299169-29299191 ATGCCAGTTCCCAGTGTCAGAGG + Intergenic
1164763270 19:30743959-30743981 GGGCCAGTGGCCAGTCTCCGAGG + Intergenic
1165730774 19:38143289-38143311 CCCCCAGGTCCCTGTCTCAGGGG + Intronic
1166377075 19:42333706-42333728 CCGCTGCTTGCCAGTCTAAGTGG + Exonic
926384233 2:12320297-12320319 CTGCCAGGTGCCAGTCACAGGGG - Intergenic
926715255 2:15919211-15919233 CCGCCAGATTCCAGGCTTAGAGG - Intergenic
929570471 2:43019666-43019688 CCTCTAGTTCCCTGTCTCAGGGG + Intergenic
932582503 2:73000914-73000936 CCTCCAGTTCCCAGACACAGAGG + Intronic
933983819 2:87574536-87574558 CTGCCAGTCCCCAGGCTCAGGGG + Intergenic
935729437 2:106053261-106053283 CTCCCAGATGCCAGTCTCTGTGG + Intergenic
936310035 2:111376258-111376280 CTGCCAGTCCCCAGGCTCAGGGG - Intergenic
939478546 2:142717927-142717949 CCTCCAGGTGCCTGTCTCAATGG - Intergenic
943892163 2:193302622-193302644 CCCCCAGTTTCCAGTCCCAGCGG + Intergenic
1171021286 20:21586599-21586621 CCTCCAGTTGCCAGTGTAACTGG - Intergenic
1171125412 20:22597930-22597952 CCTCCAGTTTCCACACTCAGTGG + Intergenic
1173866909 20:46318047-46318069 CCTGCAGTTGCCAGACTCAAAGG - Intergenic
1175439194 20:58978970-58978992 CTGCCAGGTGCCGCTCTCAGTGG + Intergenic
1180175293 21:46084258-46084280 GGACCAGTTGCCAGTTTCAGAGG - Intergenic
1182435199 22:30325968-30325990 CCACCTGTTGCCAGTGCCAGTGG + Intronic
1182525956 22:30919430-30919452 TGCACAGTTGCCAGTCTCAGAGG + Intergenic
1183178884 22:36245238-36245260 ACGCCAGATGCCAGTCTCCAAGG - Intergenic
1183301571 22:37061459-37061481 CAGCCAGGGCCCAGTCTCAGAGG - Intronic
949934116 3:9103276-9103298 TTGCCAGGTGCCAGTTTCAGGGG - Intronic
953117832 3:40010304-40010326 CCCTCAGCTGCCACTCTCAGAGG - Intronic
953841780 3:46395267-46395289 CCTCCAGGTGGCAGTGTCAGGGG + Intergenic
955611060 3:60757950-60757972 TCGCCTGTTGCCTGCCTCAGAGG + Intronic
958888711 3:99758814-99758836 CTACCAGGTTCCAGTCTCAGTGG - Intronic
962099447 3:132326429-132326451 CCTGCAGTTACTAGTCTCAGGGG - Intronic
965278169 3:166714922-166714944 CTGCCAGTTCCCGGTCTCTGTGG - Intergenic
971308421 4:25503807-25503829 CAGCCAGTTCCCAGCCCCAGGGG + Intergenic
972840735 4:42927418-42927440 CTGTCAGATGCCATTCTCAGAGG - Intronic
974936451 4:68414341-68414363 CAGCCAGTGGCCAGGCGCAGTGG + Intergenic
986029755 5:3883057-3883079 CAGCCAGATTCCAATCTCAGGGG - Intergenic
991216859 5:64165878-64165900 CCGCCAGCAGCCAGGCTCTGAGG - Exonic
997133563 5:131301168-131301190 CCTACCCTTGCCAGTCTCAGAGG - Intronic
998068466 5:139177930-139177952 CTGGGAGTTGCCAGTGTCAGTGG + Intronic
1002759383 6:190075-190097 CAGTGAGTTACCAGTCTCAGGGG - Intergenic
1017347469 6:153400994-153401016 CCACCAGTTGCCCCTCTCAATGG - Intergenic
1017891173 6:158640560-158640582 CCCCCACTTCCCAGTCTCAGGGG + Intronic
1018139247 6:160811446-160811468 CCGCCACTTGCCCCTCTCAATGG + Intergenic
1022192205 7:28027169-28027191 CAGCCCCATGCCAGTCTCAGGGG + Intronic
1022621414 7:31988199-31988221 CCTGCTGTTGCCAGTCTCTGGGG + Intronic
1023792200 7:43762001-43762023 GGGCCAGCTGCCAGCCTCAGAGG - Intronic
1024378198 7:48663366-48663388 GCGCCAGTTACCAGTCCTAGGGG + Intergenic
1032529754 7:132610327-132610349 GCTCCACTTCCCAGTCTCAGAGG - Intronic
1033121690 7:138672045-138672067 TCTCCAGTTGCCATTCACAGCGG + Exonic
1034160234 7:148988672-148988694 CACCCAGTGGCCAGGCTCAGAGG + Intergenic
1034345343 7:150382194-150382216 CAGCCAGTTGGGAATCTCAGAGG - Intronic
1035466835 7:159084779-159084801 CCGCCAGTTGCCAGTCTCAGAGG + Intronic
1036631637 8:10519985-10520007 GTGCAGGTTGCCAGTCTCAGAGG - Intergenic
1043011689 8:74888896-74888918 CCTCCATTTCCCAGGCTCAGGGG + Intergenic
1047213287 8:122856993-122857015 CTGACAGCTGCCAGTCTCTGGGG + Intronic
1048035735 8:130675670-130675692 CCGCCAGGTGGCAGTATCTGAGG - Intergenic
1055949571 9:81718473-81718495 CCCCCAGTTTCCGATCTCAGAGG + Intergenic
1056850796 9:90082053-90082075 CTGCCAGTTGGCAGTGCCAGAGG - Intergenic
1057446027 9:95115298-95115320 CCGGCATTTCCCAGTCTCAGCGG - Intronic
1062109770 9:134775667-134775689 CCGCAAGTCCCCATTCTCAGAGG - Intronic
1186295808 X:8146555-8146577 CCTCCAGGTGCAAGTGTCAGTGG - Intergenic
1187361105 X:18628506-18628528 CCGCCAGAGGCCTGGCTCAGGGG - Exonic
1195306468 X:103587856-103587878 CCTCCAGCTTCCAGTCCCAGAGG - Intergenic