ID: 1035468674

View in Genome Browser
Species Human (GRCh38)
Location 7:159096194-159096216
Sequence TGGATAGGAGGCCTGTCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 153}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035468674_1035468683 9 Left 1035468674 7:159096194-159096216 CCCAAAGACAGGCCTCCTATCCA 0: 1
1: 0
2: 0
3: 16
4: 153
Right 1035468683 7:159096226-159096248 GGAGAGTTTCAACCCCTGCCTGG 0: 1
1: 0
2: 1
3: 10
4: 115
1035468674_1035468685 11 Left 1035468674 7:159096194-159096216 CCCAAAGACAGGCCTCCTATCCA 0: 1
1: 0
2: 0
3: 16
4: 153
Right 1035468685 7:159096228-159096250 AGAGTTTCAACCCCTGCCTGGGG 0: 1
1: 0
2: 3
3: 15
4: 152
1035468674_1035468684 10 Left 1035468674 7:159096194-159096216 CCCAAAGACAGGCCTCCTATCCA 0: 1
1: 0
2: 0
3: 16
4: 153
Right 1035468684 7:159096227-159096249 GAGAGTTTCAACCCCTGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035468674 Original CRISPR TGGATAGGAGGCCTGTCTTT GGG (reversed) Intronic
900723606 1:4198881-4198903 TGGCTATGAGGGCTGTTTTTTGG - Intergenic
901077190 1:6562579-6562601 AGGATAGCAGGCTTGTCTGTTGG - Intronic
901225147 1:7608995-7609017 TGGCTAGGAGGCCTGCGTTGTGG + Intronic
904564659 1:31421407-31421429 TGGATAGGAGGCAGGTCTTGGGG + Intronic
905587774 1:39134529-39134551 TGGAAAGGAACCCTGGCTTTGGG + Intronic
906859037 1:49339100-49339122 TGGATTGGAGGGGTGTCTCTTGG - Intronic
907891508 1:58640900-58640922 TGGAAAGAAGGCTTGCCTTTGGG + Intergenic
908652688 1:66353379-66353401 TGCCTAGGAGACCTGGCTTTTGG - Intronic
908763934 1:67537522-67537544 TGAATAGAAGACCTATCTTTCGG - Intergenic
909405694 1:75286764-75286786 AGGATTGGAGTCCTATCTTTAGG - Intronic
909764565 1:79339373-79339395 ATAATAGGAGGCCTGTGTTTTGG + Intergenic
910229181 1:84968737-84968759 TGGGGAAGATGCCTGTCTTTGGG - Intronic
911367259 1:96953620-96953642 AGAATGAGAGGCCTGTCTTTTGG - Intergenic
917775590 1:178331088-178331110 TGGTTAAGAGGACTGACTTTAGG - Intronic
918074559 1:181160518-181160540 TGGGCAGGATGGCTGTCTTTGGG + Intergenic
921542159 1:216429678-216429700 TGGATTCTAGGCCTGGCTTTGGG - Intergenic
921648086 1:217643438-217643460 TGGACAGAAGGCCTGGCTTTGGG - Intronic
1065839908 10:29694049-29694071 TGGGTAGGGGGGCTGTCTATGGG - Intronic
1067317505 10:45181754-45181776 TGCATGGGAGGCCAGTCTTCAGG + Intergenic
1069107487 10:64401069-64401091 TGGATATGAGGACTCTTTTTTGG + Intergenic
1073468866 10:103710531-103710553 TGGAGAGGATGACTGTCTGTGGG - Intronic
1076025961 10:127113680-127113702 TTCATAGGAGGCACGTCTTTGGG + Intronic
1076036473 10:127202448-127202470 TGCACAGGAGGCTTTTCTTTAGG + Intronic
1078581717 11:12544096-12544118 TGGACAGGAGCCATGTCTTTAGG + Intergenic
1078890526 11:15552641-15552663 TGGAGAGGAGGCCTTTGTTAAGG + Intergenic
1079646861 11:22874781-22874803 TGGCAAGGAGGACTCTCTTTAGG - Intergenic
1080207422 11:29746596-29746618 TGAATATTAGGCCTCTCTTTTGG - Intergenic
1082163873 11:48918766-48918788 TGGATAGTTGGACTGTCTTAAGG - Intergenic
1084389388 11:68865330-68865352 TGGAGAGGAGGCCTGTTTTGCGG - Intergenic
1088155609 11:106799415-106799437 TGGCTATGAGGGCTCTCTTTTGG - Intronic
1089178687 11:116566225-116566247 TGGAGATGGGGCCTTTCTTTGGG - Intergenic
1089772207 11:120811394-120811416 TGGTTAAGGGGCCGGTCTTTGGG + Intronic
1092079626 12:5704725-5704747 TGTATAGGATGTCTGTGTTTTGG - Intronic
1092704842 12:11271210-11271232 TGGTCAAGAGGTCTGTCTTTAGG - Intergenic
1092708760 12:11311935-11311957 TGTTCAAGAGGCCTGTCTTTAGG - Intergenic
1092716745 12:11397068-11397090 CGGTCAAGAGGCCTGTCTTTAGG - Intronic
1094477486 12:30852403-30852425 TTGATAGGAAGCCTGCTTTTGGG - Intergenic
1095399457 12:41797835-41797857 TTAATAGGAAGCCTGTCTTGTGG - Intergenic
1096810704 12:54167899-54167921 TGAACAGGAGGCCTGTCTAGTGG - Intronic
1098180387 12:67840572-67840594 GGCATGGCAGGCCTGTCTTTAGG + Intergenic
1100025737 12:90125618-90125640 TGGATAGGTTGCCTGGCTCTCGG + Intergenic
1102786349 12:115608159-115608181 TGGATAGAAGGCCCATCTTCTGG + Intergenic
1104186394 12:126436140-126436162 TGGGTAGGAGGTTTTTCTTTGGG + Intergenic
1104507326 12:129344554-129344576 TGGCTTAGAGGCCTGACTTTGGG + Intronic
1107104872 13:36632256-36632278 ATGATAGAAGGCATGTCTTTAGG + Intergenic
1109531464 13:63654081-63654103 TGGCTATGCGGCCTCTCTTTTGG + Intergenic
1110748911 13:79090125-79090147 AAGATTGGAGGCCTATCTTTTGG - Intergenic
1119237033 14:73028257-73028279 ATGATAGGAGGCCTTTGTTTTGG - Intergenic
1120679406 14:87462185-87462207 TGCATAGGAGGCGTGGCTATGGG + Intergenic
1120735946 14:88052945-88052967 TGGCTATGAGGGCTGTCTTTTGG + Intergenic
1125617606 15:41029457-41029479 AGGATAGCTGGGCTGTCTTTAGG + Intronic
1130058696 15:80553176-80553198 TGTATAGGTGGCACGTCTTTAGG + Intronic
1130300966 15:82679857-82679879 AGGATAGGAGGGGTGTCTCTGGG - Intronic
1133332033 16:4980831-4980853 GGGGTAGGAGGCCTGGATTTGGG - Intronic
1133610502 16:7429040-7429062 TGGAAAGGTGACCTGTCTTGTGG + Intronic
1140782123 16:78306478-78306500 TGCACAGGGGGCCTGCCTTTGGG - Intronic
1141037404 16:80640197-80640219 TGGAAAGGAGGGATCTCTTTTGG - Intronic
1142878057 17:2864225-2864247 TGGTTAGGAAGCCTGTCCTCTGG + Intronic
1149085501 17:52710504-52710526 TGGAGAGGAGCCCTGTCTCCAGG + Intergenic
1153843220 18:9025848-9025870 AGGAGAGGAGGCATTTCTTTAGG + Intergenic
1156288971 18:35728619-35728641 TGGATATCAGGCCTCTCTGTTGG - Intergenic
1161190033 19:2949336-2949358 TGAATAGCACGCCAGTCTTTTGG - Intergenic
1164633269 19:29775387-29775409 GGGATCGGAGGCCTGTCCATTGG - Intergenic
926627259 2:15102550-15102572 TGAATAAAAGGCCTGCCTTTAGG - Intergenic
927152369 2:20203369-20203391 TGGCAAGAAGGCCTGGCTTTCGG - Intronic
927941298 2:27104487-27104509 TGAGCAGGAGTCCTGTCTTTGGG - Intronic
928941236 2:36729668-36729690 GAGATAGGAGCCCTGACTTTAGG + Intronic
929207326 2:39311635-39311657 TTGCCAGGAGGCCTCTCTTTAGG - Intronic
929557918 2:42936972-42936994 TGGAGAAGAGGCCAGACTTTAGG + Intergenic
930127907 2:47817529-47817551 TGGACAAGAGGCCTAGCTTTTGG + Intronic
935105578 2:100040310-100040332 TGGGTTGGAGGTCTTTCTTTGGG - Intronic
935890352 2:107670518-107670540 TAGAGAGTAGGACTGTCTTTTGG - Intergenic
937625451 2:124038326-124038348 TGGTTGTGAGGCCTGTCTTTGGG + Intronic
938785801 2:134628333-134628355 TTGAAAGGAGGCCTTTCTTTGGG - Intronic
945690908 2:213034352-213034374 GGCACAGGAGGCCTATCTTTTGG + Intronic
946013913 2:216588658-216588680 TGGAGAGGAGAGCTGCCTTTTGG - Intergenic
946573225 2:221047021-221047043 TCTCAAGGAGGCCTGTCTTTGGG + Intergenic
948940373 2:241192429-241192451 TGGCTTAGAGGCCTCTCTTTTGG + Intronic
1172245445 20:33442843-33442865 TGGATAGGAGGCCTGGGTGCAGG - Intronic
1172269075 20:33642992-33643014 GGGATAGAGGGCCTGTCCTTTGG + Intronic
1173000954 20:39105293-39105315 GGCATAGGAGTCCTGTCTGTGGG + Intergenic
1174532835 20:51227696-51227718 TGGATAGAGGCCCTGTGTTTTGG + Intergenic
1175208236 20:57328312-57328334 AGGAAAGGAGTCCTGACTTTGGG - Intergenic
1176105520 20:63384085-63384107 TGGAAAGGAGGCCTGTTTCCAGG + Intergenic
1177931821 21:27295079-27295101 CAGAGAGGAGGCCTGACTTTAGG - Intergenic
1178452148 21:32712037-32712059 TGGATAGTAGGCCCTTCATTTGG - Intronic
1179129340 21:38620720-38620742 TGGAGAGAAAGCCTGTCCTTGGG - Intronic
1179976734 21:44872775-44872797 TGGATAGGAGCTCTGGCTGTCGG + Intronic
1180014331 21:45072956-45072978 TGGAAAACAAGCCTGTCTTTGGG - Intergenic
1180225102 21:46387508-46387530 TGGAGAGGCTGCCTGTCTTGAGG + Intronic
1182922452 22:34092424-34092446 TGCATAAGGGGCCTGTCTTCAGG - Intergenic
949095610 3:81885-81907 TGGACAGGAAGTCTGTATTTAGG + Intergenic
950353013 3:12375697-12375719 TGGATGGGTGCCCTGTCCTTAGG + Intronic
950666286 3:14497266-14497288 TGGTTAAGAGTCCTGACTTTGGG - Intronic
950966929 3:17152920-17152942 TGGATAAGATGCCTGTCCTCAGG - Intergenic
951120030 3:18915784-18915806 TTGATTGGAGGCCAGGCTTTGGG - Intergenic
954663901 3:52240322-52240344 TGGAAAGGAGGCCAGCTTTTTGG + Intergenic
956330858 3:68106055-68106077 TAGATAGAAGGGCTTTCTTTTGG - Intronic
956746877 3:72317424-72317446 TGGAAAGGAGGCATGGCTATAGG + Intergenic
959008957 3:101051861-101051883 TGTTTTGGAGGACTGTCTTTGGG + Intergenic
959109771 3:102108430-102108452 GGCATAGGAGGCCTAGCTTTTGG + Intronic
959892133 3:111569397-111569419 TGGACAGTAGGCCTATCATTAGG + Intronic
961901229 3:130213799-130213821 TGGTTAGGAAAACTGTCTTTAGG - Intergenic
962419816 3:135218095-135218117 TGGGTAGCAGGGCTGTCTCTTGG + Intronic
963582996 3:147150364-147150386 TGAATGGAATGCCTGTCTTTAGG - Intergenic
968586293 4:1417838-1417860 TTGAGAGGAGGCCTGTGGTTTGG + Intergenic
973342189 4:49016847-49016869 CGGAGAGAAGGCATGTCTTTGGG - Intronic
973556411 4:52087742-52087764 TGGCTAGGAGGGCTCTTTTTTGG + Intronic
975435068 4:74342725-74342747 TGGAGAGGAGGCCTTTGTTTTGG - Intergenic
976086728 4:81414437-81414459 TGGCTATGAGGCCTCTTTTTTGG - Intergenic
976882254 4:89941802-89941824 TGGTTAGGAGGCCTGTCTGCTGG + Intronic
977536395 4:98260759-98260781 TCGATAGCAGGCGTGTCATTGGG - Intergenic
980546073 4:134263392-134263414 TGGATTGGAGGCATTTCTTCTGG + Intergenic
980986009 4:139694927-139694949 GGCTCAGGAGGCCTGTCTTTTGG + Intronic
982053096 4:151523099-151523121 TGGTTAGGGGGGCTGTCATTTGG + Intronic
983398692 4:167235021-167235043 TGGATAGATGGCCTTTCTTTAGG - Intergenic
989597049 5:43166260-43166282 GGCATAGGAGACCTGGCTTTCGG + Intronic
992222619 5:74587627-74587649 TGAATTGGGGGTCTGTCTTTGGG + Intergenic
992520711 5:77547801-77547823 TGGCCATGAGGCCTCTCTTTTGG - Intronic
994084744 5:95745450-95745472 CTGAAAGGATGCCTGTCTTTGGG - Intronic
994959760 5:106584338-106584360 TAGAAAGGAGGCCTGTGTGTGGG + Intergenic
998400290 5:141845292-141845314 CTGAAAGGAGCCCTGTCTTTGGG - Intergenic
998409927 5:141901932-141901954 TGGCTAGGAGGCCTGGCTCTGGG + Intergenic
998630080 5:143888474-143888496 TGGATAATAGTCCTGCCTTTGGG + Intergenic
999822127 5:155238712-155238734 TGGCAAGGAGGTTTGTCTTTAGG + Intergenic
1000717661 5:164666464-164666486 TGCTTGGGAGGCCTGTCCTTTGG - Intergenic
1001049350 5:168402134-168402156 AAGAAAGGAGGCTTGTCTTTGGG - Intronic
1003303791 6:4908367-4908389 TGGATAGGTGGTATGTCCTTGGG + Intronic
1003642304 6:7886321-7886343 TGGGGAGGGGGACTGTCTTTTGG + Intronic
1006104742 6:31709942-31709964 TGGAGGGGAAGCCTCTCTTTGGG + Intronic
1006416402 6:33906800-33906822 TGGATAGGAGGCCTGAATTCTGG + Intergenic
1010367099 6:75063696-75063718 TCAATAGAAGGCCTGACTTTTGG - Intergenic
1011945655 6:92898871-92898893 TGGATTGGAGCCCTGTTTTTTGG - Intergenic
1017041932 6:150314978-150315000 CAGATAGGTGGCCTGTCCTTAGG + Intergenic
1018218691 6:161557384-161557406 AGGTTAGGAGACCTGTATTTGGG + Intronic
1019847441 7:3520171-3520193 TGTATATGCTGCCTGTCTTTTGG + Intronic
1019924983 7:4186001-4186023 TGGACAGGAAGCCTTGCTTTAGG - Intronic
1021487887 7:21187223-21187245 AGGATATCATGCCTGTCTTTGGG - Intergenic
1022196419 7:28071639-28071661 TGGATAGAAGGTCCGTCCTTGGG - Intronic
1022786719 7:33645387-33645409 TCAATAGGAGACCAGTCTTTAGG - Intergenic
1023056980 7:36298754-36298776 TGGACAGGAGGCCTGGCCTCTGG + Intronic
1023543756 7:41295353-41295375 TGGATGGAAGCCCTGTCTATAGG + Intergenic
1031926521 7:127643802-127643824 TGGACAGGAGGCCTTTCTGCAGG + Intergenic
1032133177 7:129248570-129248592 TGGATATGAGGGCTGACTGTTGG + Intronic
1033234819 7:139629912-139629934 TTGATGGGAGGCCTGGCATTTGG - Intronic
1035468674 7:159096194-159096216 TGGATAGGAGGCCTGTCTTTGGG - Intronic
1036699551 8:11002933-11002955 TGGATAGGAGGCCCTTGTTGGGG + Intronic
1038212102 8:25528255-25528277 TGGCTATGAGGGCTGTTTTTTGG - Intergenic
1039636102 8:39167515-39167537 TGGCTATGAGGGCTGTTTTTAGG + Intronic
1042160942 8:65894613-65894635 TGGCTATGAGGGCTGTTTTTAGG - Intergenic
1045741466 8:105365385-105365407 TGGATGGTAAGCCTGTCTTGGGG + Intronic
1045783395 8:105894947-105894969 TGGATTGGGGGCTTGTATTTTGG - Intergenic
1048343376 8:133557469-133557491 TGGATAGGAGGCCAGCCCGTGGG - Intronic
1048769390 8:137879697-137879719 ATGAAAGCAGGCCTGTCTTTGGG + Intergenic
1049542578 8:143215254-143215276 TGGTCAGGAGGCCTGACTCTGGG - Intergenic
1050867708 9:10524137-10524159 TGGAGATGAGGCCTTTCTATAGG - Intronic
1054994521 9:71370321-71370343 TGGCCAGGAGGCCTAGCTTTTGG - Intronic
1058220917 9:102301147-102301169 TGCTTATGAGGACTGTCTTTGGG + Intergenic
1058986781 9:110215494-110215516 TGGATATGAGGTTTCTCTTTGGG - Intergenic
1059567824 9:115400867-115400889 TGGATGTGAGGCCTGTCTCAGGG - Intronic
1061582709 9:131547209-131547231 TGGCTCGGAGGCCTGACATTGGG - Intergenic
1187331500 X:18344407-18344429 TGTATTGGAGCCTTGTCTTTTGG - Intronic
1188363185 X:29282090-29282112 TGGAGATGAGGCCTTTCTTTGGG - Intronic
1189024569 X:37379084-37379106 TGGACAGGAGGCAAGTCTTTTGG + Intronic
1192012918 X:67294213-67294235 AGGATAGGAAGCCTGTATCTTGG + Intergenic
1192717536 X:73660035-73660057 TGGCTGGGAGGTCTGTCTTGGGG - Intronic
1193112539 X:77743904-77743926 TGCCTAATAGGCCTGTCTTTAGG - Intronic
1194827493 X:98580704-98580726 TGGCTATGTGGGCTGTCTTTTGG + Intergenic
1198110451 X:133498256-133498278 TGCATGGCAGGCCTGTCTTTTGG + Intergenic
1200521810 Y:4218367-4218389 TGGATATTAGGGCTGTTTTTTGG - Intergenic