ID: 1035470420

View in Genome Browser
Species Human (GRCh38)
Location 7:159105666-159105688
Sequence CTCACACAGGGAGCCCCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 349
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 312}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035470413_1035470420 9 Left 1035470413 7:159105634-159105656 CCAATCAGGGGCTCTGACTACAA 0: 1
1: 0
2: 1
3: 7
4: 89
Right 1035470420 7:159105666-159105688 CTCACACAGGGAGCCCCAGCAGG 0: 1
1: 0
2: 1
3: 35
4: 312
1035470410_1035470420 21 Left 1035470410 7:159105622-159105644 CCGACACCATCACCAATCAGGGG 0: 1
1: 1
2: 0
3: 10
4: 130
Right 1035470420 7:159105666-159105688 CTCACACAGGGAGCCCCAGCAGG 0: 1
1: 0
2: 1
3: 35
4: 312
1035470412_1035470420 15 Left 1035470412 7:159105628-159105650 CCATCACCAATCAGGGGCTCTGA 0: 1
1: 0
2: 0
3: 17
4: 136
Right 1035470420 7:159105666-159105688 CTCACACAGGGAGCCCCAGCAGG 0: 1
1: 0
2: 1
3: 35
4: 312
1035470406_1035470420 23 Left 1035470406 7:159105620-159105642 CCCCGACACCATCACCAATCAGG 0: 1
1: 0
2: 0
3: 7
4: 100
Right 1035470420 7:159105666-159105688 CTCACACAGGGAGCCCCAGCAGG 0: 1
1: 0
2: 1
3: 35
4: 312
1035470408_1035470420 22 Left 1035470408 7:159105621-159105643 CCCGACACCATCACCAATCAGGG 0: 1
1: 0
2: 0
3: 8
4: 146
Right 1035470420 7:159105666-159105688 CTCACACAGGGAGCCCCAGCAGG 0: 1
1: 0
2: 1
3: 35
4: 312

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035470420 Original CRISPR CTCACACAGGGAGCCCCAGC AGG Intronic
900870110 1:5296330-5296352 TTCTCTCAGGGAGCCCCTGCAGG - Intergenic
901223045 1:7594803-7594825 CTCAGAAAGGGAGGCCCAGCGGG + Intronic
902434809 1:16391630-16391652 CTCACACAGGGAGCCCACGAAGG - Intronic
902438850 1:16416098-16416120 CAGTCACAGGGAGCCCCTGCAGG - Intronic
903664441 1:24997799-24997821 CTCACAGAGGAAGCAGCAGCTGG - Intergenic
904083158 1:27884768-27884790 GTCACACGGGGATCCACAGCAGG - Intronic
904203261 1:28835607-28835629 CAAATAGAGGGAGCCCCAGCTGG + Intronic
904369442 1:30039232-30039254 CTCACACAGGGCCCACCTGCCGG + Intergenic
904932913 1:34104660-34104682 CTGCCACACGGAGCACCAGCTGG + Intronic
905686446 1:39912244-39912266 CTCACTCAGGGAGCTGAAGCGGG + Intergenic
908038969 1:60086805-60086827 CTTACTCAGGTCGCCCCAGCAGG - Intergenic
909412933 1:75375613-75375635 TTCACAAAGGGAACCCCATCAGG + Intronic
909435777 1:75640279-75640301 CTCATAGAGAGAGACCCAGCTGG - Intergenic
911238407 1:95437297-95437319 TTGAGACAGGGGGCCCCAGCAGG - Intergenic
912737728 1:112165176-112165198 CTCTGACAGGCAGCTCCAGCCGG - Intergenic
914792455 1:150890407-150890429 GTCACACAAGGAGCTCAAGCAGG + Intergenic
914850701 1:151311834-151311856 GTCACACTGGAAGCCCCAGTAGG - Intronic
915845060 1:159254052-159254074 CCTACAAAGGGAGCCCCATCAGG + Intergenic
916469291 1:165107614-165107636 CCCACAAAGGGAACCCCATCAGG - Intergenic
916518645 1:165543832-165543854 CTCCCCCAGGGAGTTCCAGCTGG + Intergenic
917740583 1:177958405-177958427 CTCAGGCTGGCAGCCCCAGCTGG + Intronic
919739715 1:200974331-200974353 CCCACACAGGGGGCCAGAGCGGG + Intronic
920367153 1:205454180-205454202 AGCACTCAGGGAGGCCCAGCAGG + Intronic
920388764 1:205585956-205585978 CTCACAAAGGGAGCCCAGGCTGG - Intronic
923685063 1:236147992-236148014 CTGGCACAAGGAGCCACAGCTGG - Intronic
1063612670 10:7576371-7576393 CCTCCACAGGAAGCCCCAGCAGG - Intronic
1063787937 10:9407220-9407242 TACACACAGAGCGCCCCAGCGGG + Intergenic
1063787943 10:9407247-9407269 TACACACAGAGCGCCCCAGCGGG + Intergenic
1063787949 10:9407274-9407296 TACACACAGAGCGCCCCAGCGGG + Intergenic
1063787959 10:9407328-9407350 TACACACAGAGCGCCCCAGCGGG + Intergenic
1063787974 10:9407409-9407431 TACACACAGAGCGCCCCAGCGGG + Intergenic
1063787980 10:9407436-9407458 TACACACAGAGCGCCCCAGCGGG + Intergenic
1064093032 10:12401599-12401621 CTCCCACAAGGAGCCTCAGAAGG + Intronic
1067091569 10:43268277-43268299 ATCCCACAGAGAGGCCCAGCAGG + Intergenic
1067363164 10:45600788-45600810 CTCCCACCGGGAACTCCAGCTGG - Intergenic
1068959570 10:62852946-62852968 CTCAGAGAGGGGGCCCCTGCTGG - Intronic
1069621953 10:69842829-69842851 CTCACACAGCGGAACCCAGCAGG - Intronic
1069661078 10:70123873-70123895 CTCACAGAGACAGCCCCAGACGG + Intronic
1069720102 10:70544440-70544462 CTCAGTCTGGGGGCCCCAGCAGG + Intronic
1070167593 10:73910615-73910637 CGCACAGAGGGAGCCCCTACAGG + Exonic
1070456963 10:76626876-76626898 CTAAACCAGGGAGCCCCAGGAGG - Intergenic
1070549433 10:77479649-77479671 CTCACACAGGTAAACCCAGGTGG + Intronic
1070808415 10:79284791-79284813 CCGACAGAGGGAGGCCCAGCAGG - Intronic
1072192484 10:93087463-93087485 CTCACCCAGGGTCCCTCAGCTGG + Intergenic
1072503774 10:96044023-96044045 CGGACGCAGGGAGCCCCAGCCGG + Intronic
1075272419 10:121063863-121063885 CTCACAGAGGCAGGCGCAGCCGG + Intergenic
1075814945 10:125257757-125257779 CTCACATAGGAAGGCCCAGGAGG + Intergenic
1076114864 10:127888257-127888279 CTCTCCCAGGGAGCCCAGGCTGG + Intronic
1076353859 10:129838388-129838410 CTCACATAGGGAGCGAGAGCAGG - Intronic
1076869275 10:133185677-133185699 CTCCCATAGGAAGCCCCAGAGGG + Intronic
1076902676 10:133347656-133347678 ATCACCCAGGGACCCCCACCCGG + Intronic
1077461668 11:2713957-2713979 CTAACTCAGGGAGCTCCAGGTGG + Intronic
1078526221 11:12103586-12103608 CTGTCTCAGAGAGCCCCAGCAGG - Intronic
1079489853 11:20975310-20975332 CACAAAAAGGAAGCCCCAGCCGG - Intronic
1080279280 11:30538018-30538040 GTGACACAGTCAGCCCCAGCAGG - Intronic
1080311885 11:30904172-30904194 TTCACCCAGGGATCCACAGCTGG - Intronic
1081329736 11:41788542-41788564 CGCCCACCTGGAGCCCCAGCTGG + Intergenic
1083255326 11:61491851-61491873 AGCCCACATGGAGCCCCAGCCGG - Intergenic
1083624960 11:64067636-64067658 CACACACAGGGTCCCCAAGCAGG + Intronic
1084029705 11:66474021-66474043 CTGCCCCAGGGAGCCCCAACAGG + Intronic
1084146533 11:67267867-67267889 GTCACACAGGTAGTCCCAGGTGG + Intronic
1084613745 11:70220861-70220883 CTTACAAAGGGAACCCCATCAGG + Intergenic
1085183977 11:74559782-74559804 CTGAGACAGGAAGCCCCAGGAGG + Intronic
1085517878 11:77121963-77121985 GCCACAGAGGGAGCTCCAGCAGG - Exonic
1085528795 11:77179622-77179644 CTCAGACAGGCACCCCCAGAAGG - Intronic
1085640390 11:78189277-78189299 GTCACACAGTGAGGCCCAGGAGG - Intronic
1087107526 11:94425112-94425134 CTTACAAAGGGAACCCCATCAGG + Intronic
1087791871 11:102414462-102414484 CTTACAGAGGGAACCCCATCAGG + Intronic
1088702192 11:112423252-112423274 CTCACACATGCAGCTGCAGCTGG - Intergenic
1089151581 11:116368620-116368642 TTGACTCAGGGAACCCCAGCAGG + Intergenic
1090810395 11:130235535-130235557 CCCACACTTGTAGCCCCAGCAGG + Intronic
1091310922 11:134574647-134574669 AGCACAGAGGGTGCCCCAGCGGG - Intergenic
1091393758 12:141333-141355 CTCACAGAGAGAGCCCGGGCAGG - Intronic
1091787510 12:3252002-3252024 CTCACGCAGGGACCCAGAGCTGG - Intronic
1092019363 12:5187925-5187947 CTCACAAAGGGAGAAACAGCAGG + Intergenic
1092553414 12:9528507-9528529 CACACACAAGGAGCCACAGTGGG - Intergenic
1094661191 12:32472092-32472114 CTCTCACAGGGAGCCTCACCTGG - Intronic
1096791301 12:54046909-54046931 CTCGCCCTGGCAGCCCCAGCGGG - Intronic
1097281093 12:57845956-57845978 GTGACAGAGGGAGCCCCAGGTGG - Intronic
1100740123 12:97582120-97582142 CTCATACGGAGAGCTCCAGCTGG + Intergenic
1100796683 12:98189358-98189380 CTCTCAGAGGGGCCCCCAGCGGG - Intergenic
1101418104 12:104526551-104526573 CTCACAAATAAAGCCCCAGCAGG - Intronic
1103891634 12:124243273-124243295 CACACACAGGGAGACCCTGAGGG + Intronic
1104677422 12:130722019-130722041 CCCACAAAGGGAACCCCATCAGG + Intergenic
1105333457 13:19440215-19440237 CACACAAAGGTAGCCCCATCAGG + Intronic
1106808473 13:33335351-33335373 CTCACACAGGGTGTCACAGAGGG - Intronic
1106835780 13:33633885-33633907 GTCACACAGGGAGCCCCAAGAGG - Intergenic
1107309384 13:39060949-39060971 CTTACAAAGGGAACCCCATCAGG - Intergenic
1107335946 13:39355158-39355180 CTTACAAAGGGAGCCTCATCAGG + Intronic
1107585989 13:41848811-41848833 TGCAGACAGGGAGCCCCTGCAGG - Intronic
1107793298 13:44024607-44024629 CTCACCTTGGGAGCCCCAGTTGG - Intergenic
1113632303 13:111896636-111896658 CTGACACAGGGTGCCCAAGCCGG - Intergenic
1113763972 13:112869395-112869417 TAAACCCAGGGAGCCCCAGCTGG + Intronic
1113796195 13:113060105-113060127 CACACCCAGGGAGACCCAGGAGG - Intronic
1113864008 13:113509291-113509313 CTAACACAGGAAGCTCCAGGGGG - Intronic
1114635488 14:24184612-24184634 CTGGCACTGGGAGCCCCACCTGG + Intronic
1114933485 14:27505305-27505327 CCTACAAAGGGAGCCCCATCAGG - Intergenic
1114989246 14:28266731-28266753 CCTACAAAGGGAGCCCCATCAGG + Intergenic
1115010095 14:28535955-28535977 CGCACAAAGGGAACCCCATCAGG - Intergenic
1121422347 14:93824596-93824618 TGCTCCCAGGGAGCCCCAGCAGG + Intergenic
1121492790 14:94372057-94372079 CTCCAACAGGGAGCCCCTCCAGG - Intergenic
1121579280 14:95014674-95014696 ATCACACAGGGGGCCTCAGGTGG + Intergenic
1121916142 14:97838449-97838471 CTCACCTGGTGAGCCCCAGCTGG + Intergenic
1122116040 14:99527742-99527764 TTCCCACCGGGAGCCACAGCTGG + Intronic
1122904904 14:104797139-104797161 GTCCCAGAGGGAGCCCCAGGTGG - Intergenic
1122945200 14:105005499-105005521 CACACACCTGGAGCCCGAGCTGG - Intronic
1122971464 14:105153990-105154012 CACACACAGGGATTCCCGGCAGG - Intronic
1122984473 14:105205851-105205873 GCCACACAGGGAGCAGCAGCTGG + Intergenic
1123066969 14:105623751-105623773 CTCACACACGGAGCCTCACCCGG - Intergenic
1123070990 14:105642478-105642500 CTCACACACGGAGCCTCACCCGG - Intergenic
1123075950 14:105667519-105667541 CTCACACACGGAGCCTCACCCGG - Intergenic
1123090655 14:105740748-105740770 CTCACACACGGAGCCTCACCCGG - Intergenic
1123096287 14:105768512-105768534 CTCACACACGGAGCCTCACCCGG - Intergenic
1123630143 15:22255551-22255573 TTCACACAGTCAGCCACAGCTGG + Intergenic
1127943692 15:63727764-63727786 CTGACACAGGGAGTAACAGCAGG + Exonic
1128672042 15:69581011-69581033 CTCACACATGGAGGCCCTACTGG + Intergenic
1129713878 15:77835955-77835977 CTCACACAGGGCTCCCCACCTGG + Intergenic
1129893762 15:79089399-79089421 CTCTAACAGGGAGCCCGGGCGGG - Intronic
1130207229 15:81888257-81888279 ATCCCACACGGAGCCTCAGCTGG - Intergenic
1130563426 15:84976196-84976218 CTCACTCAGCGGGTCCCAGCGGG - Intergenic
1130982361 15:88821474-88821496 CTCACACAGTGAGCCCCTGGGGG + Intronic
1131250655 15:90828089-90828111 GACACCCAGGGCGCCCCAGCAGG + Intergenic
1131332538 15:91515078-91515100 TGGCCACAGGGAGCCCCAGCAGG - Intergenic
1132402759 15:101523529-101523551 GTCTCACAGGGTGGCCCAGCTGG - Intronic
1132659931 16:1056788-1056810 CTCTCACAGGGAGCGGGAGCTGG + Intergenic
1133459052 16:5971026-5971048 CTCACACAGGGAGCATCCTCTGG - Intergenic
1137055959 16:35746800-35746822 CAAACTCAGGGTGCCCCAGCCGG + Intergenic
1138172675 16:54867461-54867483 CTAACACATTGAGCCCCAGAGGG - Intergenic
1138776652 16:59731091-59731113 CCTACAAAGGGAACCCCAGCAGG + Intronic
1141972950 16:87495108-87495130 TTCACACAGTCAGCCACAGCTGG - Intergenic
1142014097 16:87734702-87734724 TTCACATAGGGATACCCAGCAGG + Intronic
1142259501 16:89036210-89036232 CACACACAGGCAGCCCCACCAGG + Intergenic
1142278977 16:89137928-89137950 GGGACACATGGAGCCCCAGCTGG - Intronic
1143691882 17:8574838-8574860 CGCAGACAGGGACACCCAGCAGG + Intronic
1144721188 17:17470914-17470936 CCCACACAGAGAGAGCCAGCAGG + Intergenic
1145029694 17:19495288-19495310 GACACACAGGCAGCCTCAGCTGG + Intergenic
1145762708 17:27435260-27435282 CTCCCACAGGGAGCTCTAGAGGG - Intergenic
1146270599 17:31482872-31482894 TCCACACATAGAGCCCCAGCTGG + Intronic
1146544317 17:33725158-33725180 CTCTCACTGGGGGACCCAGCGGG + Intronic
1148089369 17:45013662-45013684 CTCCCCCAGAGAGCCCCTGCTGG + Intergenic
1148245313 17:46026360-46026382 CTGACACAGGGAGCCCCAAGGGG - Exonic
1148751838 17:49949811-49949833 ATGAAACAGGGAGCCACAGCAGG - Intergenic
1148881293 17:50729703-50729725 CCTACACAGTTAGCCCCAGCTGG + Intronic
1148931611 17:51131679-51131701 CTCACACCTGTAGTCCCAGCAGG - Intergenic
1149988869 17:61369242-61369264 CTGACAGAGGCTGCCCCAGCAGG + Intronic
1149989876 17:61377076-61377098 CTCAGCTAGGGAGGCCCAGCGGG - Intronic
1150421774 17:65043125-65043147 CTCACACAGCGAGTGGCAGCCGG + Intronic
1151948027 17:77330016-77330038 TGAGCACAGGGAGCCCCAGCTGG - Intronic
1152401794 17:80070901-80070923 CTCCCACAGGCAGGCCCAGATGG - Intronic
1152644386 17:81462038-81462060 CCCACACAGGTAGGTCCAGCGGG + Exonic
1154003373 18:10505972-10505994 CTCTCACAGGCCGCCCCATCTGG - Intergenic
1155463694 18:26112297-26112319 CTTACAAAGGGAACCCCATCAGG - Intergenic
1157428922 18:47607278-47607300 CTCACCCAAGGATCCACAGCTGG - Intergenic
1157711518 18:49852970-49852992 GTCACCAAAGGAGCCCCAGCAGG - Intronic
1158478640 18:57802557-57802579 CTCCCAAAGAGCGCCCCAGCAGG + Intronic
1160044372 18:75373079-75373101 CTCACTCAGGCATCTCCAGCAGG + Intergenic
1160205624 18:76828911-76828933 CTAACACTGGGAGGCCAAGCGGG - Intronic
1160538236 18:79606778-79606800 CACACACAGGGAGCCCTGGCAGG + Intergenic
1160559791 18:79749110-79749132 CTCAAACAGAGAGTCACAGCTGG + Intronic
1160714754 19:571162-571184 CTCAGACGGGGAGGCCCAGAGGG - Intergenic
1161302814 19:3551235-3551257 CTCACCCTGGGAGCCCTGGCTGG - Intronic
1161590756 19:5128154-5128176 CGCACACAGGGGACTCCAGCCGG - Intronic
1163375564 19:16928121-16928143 TTCACCCATGGAGCCCCAGCCGG + Exonic
1163505028 19:17700548-17700570 CTCCCCTAGGGAGCCCCAGATGG - Intergenic
1163584817 19:18157804-18157826 ATCACTCAGGGAGGCCCCGCAGG + Intronic
1166253255 19:41585623-41585645 ATCACACAGGAAACCCCAACTGG + Intronic
1166695614 19:44849752-44849774 CAGACACAGGGAGACCCAGACGG + Intronic
1167717410 19:51152705-51152727 CACACACAGAGGGCCCCAGCAGG + Intronic
1167767327 19:51492173-51492195 CACACACAGGAGGCCTCAGCAGG - Intronic
1168259759 19:55186746-55186768 CTCTCAAAGGGACCCACAGCCGG + Intronic
927093566 2:19730360-19730382 CTCTCACATGGAGCTCCTGCTGG + Intergenic
927357065 2:22186425-22186447 CCCGCACAGGGAGCGCCCGCGGG + Intergenic
927391077 2:22596230-22596252 CTCACACTGGGAGACAGAGCAGG + Intergenic
927639237 2:24836343-24836365 CTCACGCGGTGAGCCCGAGCAGG + Intronic
929400305 2:41572465-41572487 CTCACAGAGGGAGAGTCAGCAGG - Intergenic
930916126 2:56690584-56690606 CTGACAAAGGGAACCCCATCTGG + Intergenic
935987471 2:108688816-108688838 CACACACAGCGGCCCCCAGCAGG + Intergenic
936126297 2:109791513-109791535 CACACACAGCGGCCCCCAGCAGG + Intergenic
936218396 2:110579955-110579977 CACACACAGCGGCCCCCAGCAGG - Intergenic
936734735 2:115427262-115427284 CTCCCACACAGAGTCCCAGCTGG - Intronic
937080692 2:119137607-119137629 CACACAGGGGGACCCCCAGCAGG + Intergenic
937858176 2:126687704-126687726 CCCACATTGGGAGGCCCAGCTGG + Intronic
937877293 2:126835431-126835453 CTCACACACTGAGCCCCGGACGG + Intergenic
940895792 2:159080982-159081004 TTCCCACAGGGAGCCCGAGGTGG - Intronic
943257734 2:185617795-185617817 CTTACAAAGGGAACCCCATCAGG - Intergenic
943772794 2:191736857-191736879 CTGACACATTGAGCCCCTGCTGG - Intergenic
944450321 2:199835882-199835904 CTAACAAAGGGAGCCCCAGGGGG - Intronic
945041088 2:205744536-205744558 CAGACACAAGGAGCCCCAGAAGG + Intronic
946109409 2:217401199-217401221 CCCACAAAGGGAGCAACAGCAGG - Intronic
947916790 2:233837855-233837877 CTCCCCCAGGGAGCACAAGCTGG + Intronic
948385489 2:237578156-237578178 CTGAAACAGGGAGGCCCAGAGGG + Intronic
948731308 2:239965512-239965534 CTCACTCCGGGAGCCGCAACGGG + Intronic
1168835095 20:872690-872712 CTCAGGCAGGGAGCCCCTGAAGG + Exonic
1168969407 20:1920517-1920539 CAGACACAGGGCGCCCAAGCAGG - Intronic
1170893067 20:20392111-20392133 CCCACCCAGGGCGCCCCAGCAGG + Intronic
1170944755 20:20881316-20881338 CCCACAGAGGGAGCCACAGAAGG - Intergenic
1170984607 20:21245873-21245895 GTCTCTCAGGGGGCCCCAGCAGG + Intronic
1171290204 20:23978838-23978860 GTCACTCGGGGAGACCCAGCAGG + Intergenic
1172103993 20:32504929-32504951 CACACACATTGAGCCACAGCAGG + Intronic
1173670672 20:44796532-44796554 GTCACACTGTGAGCCCCTGCAGG - Intronic
1175208459 20:57329918-57329940 CCGACACAGGGAGTCCCTGCTGG + Exonic
1175520277 20:59598383-59598405 CTTACACACGGAGGCTCAGCGGG + Intronic
1176022967 20:62971406-62971428 CTCCCACACACAGCCCCAGCTGG - Intergenic
1176063245 20:63181398-63181420 GCCACACAGGGAGCCCTACCTGG - Intergenic
1176144848 20:63561006-63561028 CACACACAGGGCACCCCAGGTGG + Intronic
1176739585 21:10588388-10588410 CACACAAAGGTAGCCCCATCAGG - Intronic
1178326970 21:31654239-31654261 CGCACACCTGGAGCTCCAGCTGG - Intergenic
1178424852 21:32471106-32471128 ATAATACAGGGAGCCCCTGCAGG - Intronic
1178579733 21:33828334-33828356 CTCTGACTGGGAGCTCCAGCTGG - Intronic
1178855603 21:36247914-36247936 CTGGCACAGGGAGTGCCAGCAGG - Intronic
1179271666 21:39856210-39856232 GTCACACACGGAGCCTCAGGTGG + Intergenic
1179659023 21:42862904-42862926 CACACACCTGGAGCCCCAGAGGG - Intronic
1179985946 21:44920422-44920444 CTAACACAGGCAGGCGCAGCAGG + Intronic
1180070936 21:45435543-45435565 CTGACACATGGAGGCCGAGCTGG - Intronic
1180556459 22:16581746-16581768 CACAGACAGGGAGCCCCACCTGG + Intergenic
1180767223 22:18352175-18352197 GTCACTCGGGGAGACCCAGCAGG - Intergenic
1180779086 22:18510204-18510226 GTCACTCGGGGAGACCCAGCAGG + Intergenic
1180811807 22:18767524-18767546 GTCACTCGGGGAGACCCAGCAGG + Intergenic
1181100148 22:20533483-20533505 TCCACCCAGGGAGGCCCAGCAGG - Intronic
1181197961 22:21201766-21201788 GTCACTCGGGGAGACCCAGCAGG + Intergenic
1181401784 22:22654039-22654061 GTCACTCGGGGAGACCCAGCAGG - Intergenic
1181647767 22:24243065-24243087 GTCACTCAGGGAGACCCAGCAGG + Intronic
1183667121 22:39252517-39252539 CTCACCCAGGGTCCCACAGCTGG - Intergenic
1184115475 22:42419329-42419351 CTCCAGCAGGGAGCCCCTGCCGG - Intronic
1184740942 22:46428797-46428819 CTCACTCACGGGTCCCCAGCGGG + Intronic
1184767989 22:46581975-46581997 CTCCCACAGGGAGGCCCAGGTGG + Intronic
1203228845 22_KI270731v1_random:93069-93091 GTCACTCGGGGAGACCCAGCAGG - Intergenic
949720993 3:6990105-6990127 CATCCACAGGGAGCCCCTGCTGG - Intronic
950360110 3:12444075-12444097 GTCCTACAGGGAGCTCCAGCAGG - Intergenic
950364369 3:12472568-12472590 ATCACACACGAAGTCCCAGCAGG - Intergenic
950408248 3:12817680-12817702 CTCACTCAGGGAGGCCCTGGGGG + Exonic
950664515 3:14487146-14487168 TTCACCCAGGGAGCCCCCGCTGG - Exonic
951180657 3:19654773-19654795 CCCACACAGAGTACCCCAGCTGG - Intergenic
953928119 3:46992586-46992608 CTCAAAGAGGGAGTCCCAGGGGG - Intronic
954414929 3:50388651-50388673 CACACTGAGTGAGCCCCAGCTGG - Intronic
955228377 3:57079126-57079148 CTCACTCCGGGAGACCTAGCGGG + Intronic
961374879 3:126457511-126457533 CTCACACACGGAGACCTAGCAGG + Intronic
961668124 3:128506724-128506746 GTGACACAGGGAGACTCAGCAGG + Intergenic
962256073 3:133871126-133871148 GGCACACAGTGAGCCCCAGTGGG - Intronic
966370210 3:179243742-179243764 CACAGAGAGGGAGCCCCACCTGG + Intronic
966860342 3:184228231-184228253 AACACACAGGGAGCTCCAGCTGG - Intronic
967479158 3:189954551-189954573 CACACACTGGGAACCCCAGGAGG - Intergenic
968473474 4:792246-792268 CCCACAGAGGGAGCCCAACCCGG + Intronic
968502392 4:957009-957031 CTCCCAAGGGGAGCCTCAGCTGG - Intronic
969455487 4:7297530-7297552 TTCACCCAGGGAGACTCAGCAGG - Intronic
972326900 4:38025387-38025409 CTCACACAGCTAGCCCCTCCTGG - Intronic
972740826 4:41884606-41884628 CACACACAAGCAGCCCCTGCTGG + Intergenic
975102557 4:70531168-70531190 GCCACCCAGGGAACCCCAGCAGG + Exonic
982863368 4:160481852-160481874 CCCGCACTTGGAGCCCCAGCTGG + Intergenic
983425836 4:167582318-167582340 CCCACACAGGTTGCCCCTGCTGG - Intergenic
983730685 4:170990233-170990255 CATACACAGGGACCCCCATCAGG - Intergenic
983830957 4:172328265-172328287 CTTACAAAGGGAACCCCATCAGG - Intronic
985723120 5:1501126-1501148 CAGCAACAGGGAGCCCCAGCAGG + Intronic
986166732 5:5279152-5279174 GACACACAGGAAGCTCCAGCAGG - Intronic
986667635 5:10117113-10117135 CTCCCACAGGTGGCCCCAGCTGG - Intergenic
987583158 5:19821727-19821749 CTTACAAAGGGAACCCCATCAGG + Intronic
988654637 5:33195531-33195553 CTTACAAAGGGAGCTCCATCAGG - Intergenic
989149499 5:38284559-38284581 TTCAGATAGGGAGCTCCAGCAGG + Intronic
990500484 5:56391388-56391410 CCCACAAAGGGATCCCCATCAGG + Intergenic
991161110 5:63504289-63504311 CTTACAAAGGGAACCCCATCAGG - Intergenic
994382098 5:99083567-99083589 CTCACACAGGGAGCCCTGTGAGG + Intergenic
995074890 5:107970835-107970857 CTAACACGGGGAGCACCTGCAGG - Intronic
995309263 5:110692508-110692530 CTCACACAGGAAGCGCAAGGAGG + Intronic
995797998 5:115962102-115962124 CTAGCACACGAAGCCCCAGCTGG + Intergenic
995870582 5:116739699-116739721 CTCACACAGGGAAGCAGAGCTGG + Intergenic
995995237 5:118290653-118290675 CTCACAAAGAGGGCCCCATCAGG - Intergenic
996413813 5:123187663-123187685 CTGACACTGGCTGCCCCAGCGGG + Exonic
996558773 5:124806182-124806204 CACACATTGGGAGCCCCAGGTGG - Intergenic
997346533 5:133196302-133196324 CCCACCCAGGCAGCCCCAGACGG - Intergenic
998559228 5:143155551-143155573 CTCACACTTGGTGACCCAGCAGG + Intronic
1002282972 5:178143951-178143973 CTCCCACAGGCAGCGCCTGCTGG + Exonic
1002315790 5:178342219-178342241 CTCCCACCTGGAGCTCCAGCAGG + Intronic
1003329145 6:5115383-5115405 CTCACACAGGGAGCTACATGGGG - Intronic
1003845110 6:10165803-10165825 CTCACCCAGGTACCCTCAGCTGG + Intronic
1004278476 6:14258822-14258844 CTCACACAGGGAGGCAGAGAGGG + Intergenic
1006742463 6:36319355-36319377 CCCATACAGGGAGGACCAGCCGG - Exonic
1007069903 6:39028886-39028908 CTCACACGGTGAGCCCCCACAGG + Intronic
1007791953 6:44314601-44314623 ATCACACAGAAATCCCCAGCTGG - Intronic
1008537516 6:52518136-52518158 CACATACAGTGAGCCACAGCAGG + Intronic
1008870756 6:56269695-56269717 CTAACAAAGGGAACCCCATCAGG + Intronic
1009704052 6:67221677-67221699 CTTACAAAGGGAACCCCACCAGG + Intergenic
1011484502 6:87828226-87828248 CTCTCACCAGGGGCCCCAGCTGG - Intergenic
1015028836 6:128569765-128569787 ATCACATAGGGATCCCCAGGAGG + Intergenic
1015791476 6:136968407-136968429 CTCAAACAGCAAGTCCCAGCGGG - Intergenic
1016495422 6:144656439-144656461 CTCACTCTGGTTGCCCCAGCTGG + Intronic
1017239230 6:152148333-152148355 CTCAGACAGGGAGCTGGAGCTGG - Exonic
1017762630 6:157582605-157582627 CTTACAAAGGGAGCCCTATCAGG - Intronic
1018496869 6:164357204-164357226 CTTAAAAAGGGAACCCCAGCAGG - Intergenic
1018669780 6:166168496-166168518 CTCGCCCACGGAGCCCCAGGCGG + Exonic
1018824902 6:167401703-167401725 TGCACACAGGGAGCCACAGTCGG + Intergenic
1019406587 7:887236-887258 CTCACTCAGGGACGCCCAGCAGG + Intronic
1019435479 7:1020255-1020277 CTCTCTCAGGGAGCCCCAGGAGG - Intronic
1019923149 7:4175402-4175424 CTCACGCAGGGAGCCCCGGCTGG - Intronic
1020016110 7:4833117-4833139 GCCACACAGCGAGCCCCAGGTGG + Intronic
1021750601 7:23795499-23795521 CTCCCACACAGAGCCCCAACTGG + Intronic
1023497489 7:40814090-40814112 CTTACAAAGGGAGCCCCATCAGG - Intronic
1025113594 7:56239397-56239419 CTCACAGAGGCAGACACAGCTGG - Intergenic
1027956581 7:84886553-84886575 CTCATAAAGGGAACCCCATCAGG - Intergenic
1029406124 7:100374889-100374911 CTCATTCAGGAACCCCCAGCAGG + Intronic
1029710045 7:102294569-102294591 CTCACTCAGGGAGCACCCACGGG + Intronic
1032086815 7:128888812-128888834 GGCACCCCGGGAGCCCCAGCAGG + Intronic
1032844662 7:135742156-135742178 CTCACACAGGGAGTCAGATCTGG - Intronic
1033036241 7:137878739-137878761 CACTCACAGGGAGCCCCAAATGG + Exonic
1034773447 7:153802250-153802272 GCCACACAGGGGGCCCCAGGAGG + Intergenic
1034924381 7:155109635-155109657 CACACACAGTGTGTCCCAGCTGG - Intergenic
1035470420 7:159105666-159105688 CTCACACAGGGAGCCCCAGCAGG + Intronic
1035980873 8:4370317-4370339 CTTACAAAGGGACCCCCATCAGG - Intronic
1037409007 8:18574435-18574457 ATCACACAGGGACCCATAGCTGG - Intronic
1037664723 8:20958020-20958042 CTCACAAAGGGAAGCCCATCAGG + Intergenic
1039424900 8:37477643-37477665 CTCAGAAAAGGAACCCCAGCTGG - Intergenic
1040811918 8:51462895-51462917 CTTACAAAGGGAGCCCCATAGGG + Intronic
1044955741 8:97477736-97477758 CATACAAAGGGAACCCCAGCAGG + Intergenic
1046754336 8:117957475-117957497 CTTACGGAGGGAGCCCCAACGGG + Intronic
1047743622 8:127827435-127827457 CCTATACAGGGAGCCCCAGGGGG - Intergenic
1049229553 8:141474921-141474943 CTCACCCAGGGAGTGCCACCTGG - Intergenic
1049512751 8:143037999-143038021 GACCAACAGGGAGCCCCAGCAGG + Intergenic
1050583183 9:7082354-7082376 GTTACACAGAGAGCCCAAGCAGG + Intergenic
1051705515 9:19875516-19875538 CTCACAGATGGAGCCCTTGCAGG - Intergenic
1051885853 9:21891891-21891913 CTGACAAAGGGACCCCCATCAGG + Intronic
1053371818 9:37567900-37567922 CTCTCAGTGGCAGCCCCAGCAGG - Intronic
1055343679 9:75311883-75311905 CACACAGAGGGATCCCCATCAGG - Intergenic
1057061904 9:92011209-92011231 CTCCTTAAGGGAGCCCCAGCAGG + Intergenic
1058058787 9:100474032-100474054 ACCACACCGGGAGCCCCGGCCGG - Intronic
1058401510 9:104625103-104625125 CTCGCCCAGGGAACCCCTGCTGG + Intergenic
1058499029 9:105591721-105591743 CTCCCACAGAGAGCCCCCACTGG - Intronic
1058826896 9:108783203-108783225 CTCACCCAGGAAGCCCAGGCAGG + Intergenic
1059363897 9:113770403-113770425 CTCAGACAGAGAGGCCCAGCTGG - Intergenic
1059425839 9:114220420-114220442 CTCAGGCAGGAAGCCCCAGGGGG - Intronic
1060847241 9:126847249-126847271 CTCACGCAGGGAACGGCAGCTGG + Intergenic
1060877943 9:127096561-127096583 CCCACAAAGGCAGCCCCAGCTGG - Intronic
1060971068 9:127738473-127738495 CGAAAACAGGGAACCCCAGCAGG + Exonic
1062043574 9:134415143-134415165 CCCACACAGGGAGACTCAGGCGG - Intronic
1062341921 9:136097538-136097560 CTCACTCAGGGGTCCCCAGCAGG + Intergenic
1062443022 9:136579494-136579516 CTCAAACCGGGACCTCCAGCAGG + Intergenic
1062715452 9:138007977-138007999 CTGAGAGAGGGAGCCCCTGCTGG - Intronic
1189189551 X:39088646-39088668 CCCACAGAGGGAGCCAAAGCAGG + Intergenic
1189208663 X:39264171-39264193 CTCTCACATGGAGGCCAAGCAGG + Intergenic
1189378016 X:40480831-40480853 TCCACACAGGGGGCCCTAGCAGG - Intergenic
1190215897 X:48479142-48479164 CACACACAGGGGGCCCCGCCTGG - Intronic
1191985008 X:66970223-66970245 CTCACAAAGGGAAGCCCATCAGG + Intergenic
1193440380 X:81533773-81533795 CCTACAAAGGGAGCCCCATCAGG - Intergenic
1193884305 X:86965511-86965533 CCTACAAAGGGAGCCCCATCAGG + Intergenic
1194130225 X:90072718-90072740 CTTACAAAGGGAGCCCCATCAGG - Intergenic
1195500494 X:105592806-105592828 CTTACAAAGGGAACCCCATCAGG - Intronic
1196152491 X:112390693-112390715 CTGACAAAGGGAACCCCATCAGG - Intergenic
1200477966 Y:3664841-3664863 CCTACAAAGGGAGCCCCATCAGG - Intergenic
1201177974 Y:11321539-11321561 CCATCGCAGGGAGCCCCAGCCGG - Intergenic
1201513277 Y:14788894-14788916 CTCACCCAGGGAGCTCCTCCAGG + Intronic
1201705278 Y:16929737-16929759 CCCACAAAGGGAACCCCATCAGG + Intergenic