ID: 1035470420

View in Genome Browser
Species Human (GRCh38)
Location 7:159105666-159105688
Sequence CTCACACAGGGAGCCCCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 349
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 312}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035470413_1035470420 9 Left 1035470413 7:159105634-159105656 CCAATCAGGGGCTCTGACTACAA 0: 1
1: 0
2: 1
3: 7
4: 89
Right 1035470420 7:159105666-159105688 CTCACACAGGGAGCCCCAGCAGG 0: 1
1: 0
2: 1
3: 35
4: 312
1035470406_1035470420 23 Left 1035470406 7:159105620-159105642 CCCCGACACCATCACCAATCAGG No data
Right 1035470420 7:159105666-159105688 CTCACACAGGGAGCCCCAGCAGG 0: 1
1: 0
2: 1
3: 35
4: 312
1035470412_1035470420 15 Left 1035470412 7:159105628-159105650 CCATCACCAATCAGGGGCTCTGA 0: 1
1: 0
2: 0
3: 17
4: 136
Right 1035470420 7:159105666-159105688 CTCACACAGGGAGCCCCAGCAGG 0: 1
1: 0
2: 1
3: 35
4: 312
1035470410_1035470420 21 Left 1035470410 7:159105622-159105644 CCGACACCATCACCAATCAGGGG 0: 1
1: 1
2: 0
3: 10
4: 130
Right 1035470420 7:159105666-159105688 CTCACACAGGGAGCCCCAGCAGG 0: 1
1: 0
2: 1
3: 35
4: 312
1035470408_1035470420 22 Left 1035470408 7:159105621-159105643 CCCGACACCATCACCAATCAGGG 0: 1
1: 0
2: 0
3: 8
4: 146
Right 1035470420 7:159105666-159105688 CTCACACAGGGAGCCCCAGCAGG 0: 1
1: 0
2: 1
3: 35
4: 312

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035470420 Original CRISPR CTCACACAGGGAGCCCCAGC AGG Intronic