ID: 1035471223

View in Genome Browser
Species Human (GRCh38)
Location 7:159110139-159110161
Sequence CTTAAAATTCAGAAGGTACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 409
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 379}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035471223_1035471225 28 Left 1035471223 7:159110139-159110161 CCATGTACCTTCTGAATTTTAAG 0: 1
1: 0
2: 2
3: 27
4: 379
Right 1035471225 7:159110190-159110212 CATTTCCTAGTGTGATGAAATGG 0: 1
1: 0
2: 2
3: 14
4: 229
1035471223_1035471226 29 Left 1035471223 7:159110139-159110161 CCATGTACCTTCTGAATTTTAAG 0: 1
1: 0
2: 2
3: 27
4: 379
Right 1035471226 7:159110191-159110213 ATTTCCTAGTGTGATGAAATGGG 0: 1
1: 0
2: 3
3: 12
4: 303

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035471223 Original CRISPR CTTAAAATTCAGAAGGTACA TGG (reversed) Intronic
900655427 1:3754504-3754526 CTAAAAATTCAGTAGGGTCAGGG + Intronic
900855909 1:5183742-5183764 CTCAAAATTCAAAAGGAACTGGG - Intergenic
901189125 1:7394570-7394592 CTTAATATCCAGAATGTATAAGG - Intronic
901698062 1:11025081-11025103 TGCAAAATTCAGATGGTACAGGG - Exonic
904427327 1:30437439-30437461 CCTAGATTTCAGAAGATACATGG + Intergenic
904958285 1:34307090-34307112 CATAGAATTCAGAATGTAAATGG + Intergenic
905709867 1:40092657-40092679 CTTAATATCCAGAATATACAAGG + Intronic
906903781 1:49866234-49866256 ATTCAAATTCAGAAAATACAGGG + Intronic
907633671 1:56110205-56110227 CTAAATATTCAGAATCTACAAGG - Intergenic
907821212 1:57971431-57971453 CTGAAAAATTATAAGGTACATGG + Intronic
909053964 1:70800837-70800859 CTGAAGATTCAGAAGGAGCAGGG - Intergenic
909275653 1:73683120-73683142 CTTAATATTCAGAATCTATAAGG - Intergenic
910744923 1:90562977-90562999 CATAAAATTCAAAAGGCAGAAGG - Intergenic
910866483 1:91792752-91792774 CTTCAAAGTCAGAGGGTACTAGG + Intronic
911649971 1:100376752-100376774 CTTATAATACAGAAAGTTCATGG + Intronic
911769887 1:101726938-101726960 CTAAAAATTCAGAACTGACATGG - Intergenic
912052564 1:105548455-105548477 CTTTACATTCACAAGGTGCATGG + Intergenic
912686029 1:111765871-111765893 CTTCAAATTCAGAAAGCTCATGG + Exonic
913038499 1:114999519-114999541 CATAAACTTCAGAAGATGCATGG + Intergenic
913225603 1:116695614-116695636 TATAAAATTCAAAAGGGACAAGG - Intronic
913361771 1:117989056-117989078 TTAAAAATTCAAAAGCTACAGGG + Intronic
913371306 1:118102874-118102896 CTTAACATCCAGAAGCCACATGG - Intronic
913675819 1:121139167-121139189 CTTCAAAGTCAGGAGCTACATGG + Intergenic
914698815 1:150111757-150111779 TTTTTAATTCAGAAAGTACAAGG + Intronic
914772680 1:150704277-150704299 CTTCAAGTTCAGAAGATGCAGGG + Exonic
916008538 1:160683594-160683616 CTGAAAATTCAGAAAGTCCTGGG - Intronic
916883913 1:169048465-169048487 CTTTAAATTGAAAATGTACATGG + Intergenic
918295879 1:183156512-183156534 GTTAATATTCAGAAATTACAAGG - Intergenic
918652079 1:186977760-186977782 CATCAACTTCAGAAAGTACAGGG + Exonic
919308020 1:195869219-195869241 CTTAGAATTCATAATATACATGG - Intergenic
919507296 1:198415365-198415387 TTTAAAAATCACAAGGTACAAGG + Intergenic
919663831 1:200273353-200273375 CTTCATATTCATAAGGCACAAGG + Intergenic
920228940 1:204457720-204457742 CCTAAAATTCAGAAGGTAAAGGG - Exonic
920258013 1:204669576-204669598 GGTAAAATTCTGAAGGTACAGGG + Intronic
920463187 1:206158004-206158026 CTTCAAAGTCAGGAGCTACATGG + Intergenic
921000586 1:211039274-211039296 CCTAGATTTCAGAAGATACATGG + Intronic
923223647 1:231918994-231919016 CTTAAAATTGAGGAGCTTCATGG - Intronic
923388185 1:233486680-233486702 CTTGAAAATCAGAAGGAAGATGG - Intergenic
924399053 1:243658211-243658233 CTTAATATTCAAAATGTATAGGG + Intronic
1063548451 10:7004979-7005001 TTTAAAATCCAGAATCTACAAGG + Intergenic
1063819236 10:9815555-9815577 ATTAAATTTCAGAAAGTAGATGG - Intergenic
1064235901 10:13574937-13574959 CTTATAATTCTTATGGTACAGGG - Intergenic
1064439000 10:15336509-15336531 CTTAAAATTGAAAAAGTACATGG - Intronic
1064758026 10:18589394-18589416 GTTCAAATTCAGAAAGTACAGGG + Intronic
1065077828 10:22098646-22098668 CTAGGACTTCAGAAGGTACAGGG - Intergenic
1065252670 10:23832415-23832437 CATAAAATCCAGAAAGGACAGGG - Intronic
1065564282 10:26993529-26993551 CTTGAAATTCAGCAGTTACTTGG + Intronic
1066262207 10:33739867-33739889 GTAAAAATTCAGAAATTACATGG - Intergenic
1066489504 10:35881162-35881184 CTAAATATTCTAAAGGTACATGG - Intergenic
1068249363 10:54416998-54417020 CTTAACATGCAGAAGTCACAAGG - Intronic
1068380153 10:56242745-56242767 CTAAAAATACAAAAGGTACCCGG - Intergenic
1068627491 10:59264893-59264915 CTTTAAATTAAGGATGTACAAGG + Intronic
1069203323 10:65651638-65651660 ATTAATATTCAGAATATACAAGG - Intergenic
1069661145 10:70124245-70124267 AATTAAATTCAGAAGGAACAAGG + Intronic
1069846923 10:71378634-71378656 TTTTAGATTCAGTAGGTACAGGG - Intergenic
1070143460 10:73756240-73756262 CTTAAATTTAAGCAGGTACTGGG + Intronic
1071131752 10:82402305-82402327 CTGAAATTTCAGAAGGTTCATGG - Intronic
1071170126 10:82854511-82854533 CTTCAAATGCAGAAGGTATCTGG - Intronic
1071381744 10:85071531-85071553 CTTAATATTCAAAATATACAAGG + Intergenic
1071421369 10:85503566-85503588 ATTCAAATTCAGAAAATACAGGG - Intergenic
1071580344 10:86763421-86763443 CTTAAAAAATAGAAGGAACATGG + Intronic
1072911914 10:99509798-99509820 ATTAATAATCAGAAGATACAAGG + Intergenic
1073549911 10:104389105-104389127 CTGAAAATTCATAAAGTATATGG - Intronic
1073932942 10:108597794-108597816 CTGGAGATTCAGAAGGTACAGGG - Intergenic
1074881386 10:117662100-117662122 ATTAAAATTCAGTATCTACAAGG + Intergenic
1074965840 10:118490159-118490181 CTTAGATTTCAGAGGGTATATGG + Intergenic
1076932340 10:133540542-133540564 CTTAAAATTGAGAATATCCAAGG + Intronic
1077750981 11:4969793-4969815 CTGATAACTCAGAAGATACAAGG + Intronic
1078373653 11:10774221-10774243 CAAAAGATTCAGAAGGTAAAAGG - Intronic
1079684578 11:23341871-23341893 CTTGAAATTCAGCAGATTCAGGG + Intergenic
1079724150 11:23859051-23859073 CCTAATATTCAGAATCTACAAGG + Intergenic
1082130333 11:48481167-48481189 CTTAAAAAACAGAAAGTACCAGG - Intergenic
1082971350 11:59025087-59025109 CTTAGAAGTTAGAAGGTACCTGG - Intronic
1083528059 11:63390054-63390076 CCTAATATCCAGAATGTACAAGG - Intronic
1084538311 11:69771439-69771461 ATTAAAATTCAGAAAGTCGACGG + Exonic
1085534333 11:77208974-77208996 CTGAAGAATCAGAAGATACAAGG - Intronic
1085790186 11:79490845-79490867 CTTAAAATTCTGAAATTACTTGG + Intergenic
1086799473 11:91153469-91153491 CTTAAAATTCTTAATTTACAAGG - Intergenic
1086877753 11:92117591-92117613 ATTAATATTCAGAATCTACAAGG + Intergenic
1086969535 11:93065803-93065825 CTTAGATTTCAGAAGATATATGG - Intergenic
1087066684 11:94034026-94034048 CTTAAAATGCTGAAAGGACATGG + Intronic
1087594418 11:100235592-100235614 CTTAAAAGACATAATGTACAAGG - Intronic
1088056453 11:105585919-105585941 ATTAATATTCAGAATATACAAGG - Intergenic
1089276577 11:117340415-117340437 CTTATAATTCAGGTGGTTCATGG + Intronic
1089858959 11:121572045-121572067 CTTAGAATTAACAAGTTACAAGG + Intronic
1090877113 11:130800489-130800511 ATTAATATCCAGAATGTACAAGG - Intergenic
1094213460 12:27916974-27916996 CTTAATATCCAGAATATACAAGG + Intergenic
1095091115 12:38106705-38106727 CTGTAAATTCATAAGGTCCAGGG + Intergenic
1095565632 12:43620582-43620604 ATTAATATTCAGAATATACAAGG - Intergenic
1096043132 12:48538158-48538180 ATTAATATTCAGAATGTACAAGG + Intergenic
1096162312 12:49389026-49389048 CTTAAAAATCAGAAGAAAAAAGG - Intronic
1096354035 12:50925091-50925113 CAGAAAGTTCAGCAGGTACAAGG - Exonic
1096528595 12:52229513-52229535 CATAAAGTTCAGCAGGTACATGG + Intergenic
1096853178 12:54456298-54456320 GTTAAAGATCAGAAGGTACTTGG - Intronic
1098835363 12:75418378-75418400 CTTACAATTTGGAAGGTATAAGG + Intronic
1099248988 12:80228988-80229010 GTTAATATTCTCAAGGTACATGG - Intronic
1099580447 12:84440067-84440089 CTCAAAATCCAGAAGGGAAAGGG - Intergenic
1101251512 12:102940347-102940369 CATAAAATTCAGAATCTAGATGG + Intronic
1101590707 12:106122743-106122765 GTTAAAATGCAGAAGATACTCGG + Intronic
1102607016 12:114075670-114075692 CTTAAAAGGCTGAAGGTGCAGGG - Intergenic
1104366846 12:128185850-128185872 TTTTAGATTCAGGAGGTACATGG + Intergenic
1106541357 13:30693048-30693070 ACTAATATTCAGAAGCTACAAGG - Intergenic
1107306783 13:39030416-39030438 CTTAAAATTCAGAGGTGGCAAGG - Intronic
1107490470 13:40876392-40876414 CTTTAAAATAAGTAGGTACAAGG + Intergenic
1108120595 13:47181747-47181769 GTTAAAATTCTGAAACTACATGG - Intergenic
1108250392 13:48561244-48561266 CTTAGAATTCATATTGTACATGG + Intergenic
1108458429 13:50640882-50640904 CTTTAGATTTAGCAGGTACATGG + Intronic
1108748939 13:53426469-53426491 TTTTAGATTCAGAAGGTACGTGG + Intergenic
1109591996 13:64497273-64497295 CTTAAAATTCAGATATTAAAAGG + Intergenic
1109808394 13:67474722-67474744 CTTAATATTCAGAATATATATGG - Intergenic
1109991045 13:70058061-70058083 CTTAAAAATCAGATGATAGAAGG + Intronic
1110682084 13:78326003-78326025 CTTTAAACTCAGAAGGTGAATGG + Intergenic
1110835913 13:80082646-80082668 CCTAAAATTCAGCAAGCACAAGG - Intergenic
1111366405 13:87251373-87251395 CTTAAAATATAGAAGATACAGGG + Intergenic
1111391774 13:87605832-87605854 CTTAATATCCAGAATCTACAGGG + Intergenic
1111454794 13:88466455-88466477 CTAAAAATTCAGAAAGTAGCTGG + Intergenic
1112697519 13:101967168-101967190 CTTAAAATTCAGATTTTTCAAGG + Intronic
1112852234 13:103720266-103720288 TTTAAAAATTAGAAGGCACAGGG + Intergenic
1113195188 13:107795572-107795594 CTCAAAATTCAGAAGGTAGAAGG + Intronic
1114418432 14:22559465-22559487 TTTACAAATCAGAAGGCACATGG + Intergenic
1115294891 14:31814413-31814435 GTTAATATCCAGAATGTACAAGG - Intronic
1116984184 14:51202690-51202712 CATAGAATTCAGAAGCTAGATGG - Intergenic
1117207083 14:53454344-53454366 CCTAAAATTCAGAAGTAACTGGG + Intergenic
1117301246 14:54430545-54430567 TTTAAAATTAAGATGGTAAAAGG - Intronic
1118109390 14:62699019-62699041 CTTAAAGGGCAGAATGTACATGG - Intergenic
1118449141 14:65881913-65881935 ATTAATATTCAGAATATACAAGG - Intergenic
1118477165 14:66128333-66128355 CTTAAAATCAGGAAGCTACAGGG - Intergenic
1118513951 14:66507171-66507193 TTTAAAATTCAGAAGTTGAAAGG + Intergenic
1118717291 14:68569454-68569476 CTCAAATTTCACAAGTTACAGGG + Intronic
1124478011 15:30052496-30052518 ACTAATATTCAGAATGTACAAGG - Intergenic
1125855374 15:42943833-42943855 ATTACAATTCAGAAGGTATCTGG - Exonic
1126513955 15:49513480-49513502 TTTAATATCCAGAATGTACAAGG - Intronic
1127068359 15:55263671-55263693 TTTAAAATTAAGAAGAGACATGG - Intronic
1128624237 15:69183044-69183066 ATTAAAATTGAGAAGGTTTAAGG + Intronic
1131715758 15:95109044-95109066 ATTAAAATTCACAATATACATGG + Intergenic
1132008981 15:98257505-98257527 CCTCAAATTCAGAAGGGAAATGG - Intergenic
1132440178 15:101854835-101854857 CTTAAAATTCAGAACTCAAATGG + Intergenic
1133545525 16:6802513-6802535 CTTAAAATACAAAAGTTACTCGG + Intronic
1139452782 16:67044923-67044945 CTTAAAATCCAGATGTGACAAGG - Intronic
1140019532 16:71224894-71224916 CTAAAATTTCAGAAGGGAAATGG + Intronic
1140498847 16:75414996-75415018 CTTAAAAGTCACAATGAACAGGG - Intronic
1140623249 16:76762301-76762323 CAGAAAACTCAGAAGGTAAAGGG - Intergenic
1141110366 16:81266527-81266549 CTTCGAGGTCAGAAGGTACACGG + Intronic
1141382787 16:83590830-83590852 TTTATGATTCAGAAGGTTCAGGG - Intronic
1143975048 17:10823437-10823459 CTCACAATGCAGAAGGAACAAGG + Exonic
1145181430 17:20756283-20756305 CTTAACATTCAGTAAGTACGTGG - Intergenic
1145859710 17:28198973-28198995 CTTAAAATTGAGAAGTCAGAAGG + Intergenic
1146989340 17:37253739-37253761 CATAAAATAAATAAGGTACAAGG - Intronic
1147271442 17:39274883-39274905 CTTAAAATTCCAAAGTTCCAAGG + Intronic
1148847168 17:50536261-50536283 CTTACAATTCAGCAGGCACTTGG - Intronic
1149574075 17:57698763-57698785 TTCAAAATTCAAAAGATACAAGG + Intergenic
1150180676 17:63117184-63117206 CTTAACATTCAGGAGTAACAAGG - Intronic
1150526982 17:65934025-65934047 CTAAAAATACAAAAGTTACATGG + Intronic
1150931100 17:69586319-69586341 TTTTAGATTCAGGAGGTACATGG - Intergenic
1152311345 17:79551990-79552012 CCTAAAATTCAGTAGGCATAGGG + Intergenic
1153000073 18:446856-446878 CTTTAAATTCTGAAGATAAATGG - Intronic
1153085367 18:1279379-1279401 CTTAGAATTCAGAACCTAGATGG + Intergenic
1154049767 18:10943047-10943069 CCTAGATTTCAGAAGATACATGG + Intronic
1155487570 18:26362752-26362774 CTTAAAGTACAGGAAGTACAGGG - Intronic
1155503423 18:26509801-26509823 CTTCAGATTCCGAAGGAACAGGG - Intronic
1155715556 18:28938546-28938568 ATTAAAATGAAGAAAGTACAAGG + Intergenic
1155763142 18:29591006-29591028 TCTAATATTCAGAATGTACAAGG + Intergenic
1156271626 18:35539671-35539693 GTTAGAAATCACAAGGTACAAGG + Intergenic
1157819886 18:50759276-50759298 CTTAAAAGTCAGAACTTCCAAGG + Intergenic
1158875048 18:61725520-61725542 CCTAAAATTCAGGAGGCAAATGG - Intergenic
1164651734 19:29895609-29895631 CTTAAAAATCAGAGGGGACACGG + Intergenic
1164913080 19:32027862-32027884 CTGAAAATGCAGAAGGAACAGGG + Intergenic
1165351083 19:35276353-35276375 CTTAAAATTCAGAAGCTGGGTGG - Intronic
924969825 2:115666-115688 TTTACAATGCAGAAGGTAGACGG + Intergenic
925763775 2:7211447-7211469 GTTAAAATTCCGTAGGTGCAAGG - Intergenic
926367323 2:12145286-12145308 ATTTGAATCCAGAAGGTACATGG - Intergenic
926508129 2:13741108-13741130 CTTAAATTTCAGAAGATGTATGG + Intergenic
927315469 2:21676184-21676206 ATAAAAATTCCTAAGGTACAGGG + Intergenic
928012087 2:27618732-27618754 TTTAAAGTTCAGAAGGTCAAGGG + Intronic
928808077 2:35186141-35186163 CTTAAAATAGATAAGGTAAAAGG - Intergenic
928869536 2:35960468-35960490 CTCAAACTTAAGAAGGCACACGG - Intergenic
930194161 2:48492641-48492663 CTTAAAATGCACAAGCCACATGG - Intronic
930291593 2:49500656-49500678 AATAAAATTCAGAAGTAACAAGG + Intergenic
930633410 2:53779264-53779286 ATTAAAATTCAGAATATAAAAGG - Intronic
930729274 2:54712102-54712124 CTCAAAATCCAGAAGCAACATGG - Intergenic
931145650 2:59514264-59514286 CTTAGAAGTGAGAATGTACAGGG - Intergenic
931217001 2:60254917-60254939 ATTAATATTCAGAATATACAAGG - Intergenic
931319579 2:61163139-61163161 CTTAGAAAACAGAAGGGACATGG + Exonic
933271035 2:80233112-80233134 CTGAAAATTCAGTAGGAACCTGG + Intronic
935004170 2:99054617-99054639 CTTAATATTCAAAATATACAAGG + Intronic
935373601 2:102373225-102373247 TTTAAAATTCAACAGGTAAAAGG - Intronic
935439825 2:103079564-103079586 ATTAATATTCAGAATATACAAGG + Intergenic
937988784 2:127650842-127650864 GATAAAATCCAGAAGGTAGAAGG - Exonic
938649153 2:133363134-133363156 GGTAAAATTGAGGAGGTACAAGG + Intronic
941135015 2:161704743-161704765 CTTAATATTCAGTGGTTACATGG + Intronic
941338739 2:164278749-164278771 GTTAATATCCAGAATGTACAGGG - Intergenic
941477580 2:165968118-165968140 CTTAGATTTCAGAAGATGCATGG + Intergenic
942369718 2:175270570-175270592 CTTGGAATTCACAAGGGACAGGG + Intergenic
942684118 2:178512777-178512799 CTTAAAATTCTGAGAGAACAGGG + Exonic
943029052 2:182665330-182665352 CCTAATATTCAGAAGCTACAAGG + Intergenic
943159044 2:184222748-184222770 CTAAAAATTCAGAAAATAAAAGG - Intergenic
943232249 2:185269117-185269139 GTTAAAATTCAAAATGTATAGGG - Intergenic
943245978 2:185451325-185451347 CTTGGATTTCAGAAGATACATGG - Intergenic
943645754 2:190407197-190407219 CTCAAAATTCAGAAACTTCAGGG + Intergenic
943757952 2:191577092-191577114 TTTAAAATACAGAAGGGAGATGG - Intergenic
945518313 2:210790971-210790993 TTTAAAATTCTTATGGTACATGG - Intergenic
1168860250 20:1041057-1041079 GTTGAAACTCAGAAGATACAAGG - Intergenic
1169312096 20:4551849-4551871 CATAGAATTCAGAAGTTAAATGG + Intergenic
1169510056 20:6254424-6254446 GTTAATATCCAGAAGCTACAAGG - Intergenic
1169845686 20:9988753-9988775 CTTAAAATTCATAAGGGTCTTGG + Intronic
1173139713 20:40471157-40471179 CTTATAATTCAGCAGGGAAAAGG + Intergenic
1174236181 20:49094174-49094196 CCTGAAATTCAGAAGGTATCTGG + Exonic
1175109709 20:56638838-56638860 CTTAAAATACAGAACCTCCACGG - Exonic
1175979646 20:62731382-62731404 ATTAAAATTAAGAAATTACACGG - Intronic
1176612290 21:8994127-8994149 TTTAAAATTCAGTTGTTACAGGG + Intergenic
1176704406 21:10101203-10101225 CTTAGATTTCAGAAGATATATGG - Intergenic
1176925374 21:14743205-14743227 CTTCAGATTCAGAGGGAACAAGG + Intergenic
1177358352 21:20037642-20037664 CCTAGATTTCAGAAGATACATGG + Intergenic
1178294300 21:31395946-31395968 TTTAAAATTCAACAGGAACATGG + Intronic
1178580368 21:33832914-33832936 TTTAAAATTCAAAAGTTACAAGG + Intronic
1179116257 21:38495432-38495454 CTTAAAAATCAGACAGGACATGG - Intronic
1183219333 22:36502466-36502488 CTTAAAATAAAGAAAGTACTTGG - Intronic
1184126047 22:42488072-42488094 CTAAAAATACAGAAGTTACCCGG + Intergenic
949106769 3:208904-208926 CTAAAATATCAGATGGTACAGGG + Intronic
949292457 3:2482815-2482837 CTTAGATTTCAGAGGGTATATGG + Intronic
949460548 3:4288547-4288569 CTCAAAAATTAGAAGCTACAAGG + Intronic
949498382 3:4655170-4655192 CTTGAAATAAAGAAGGTGCAAGG - Intronic
951146098 3:19229379-19229401 CCTAGATTTCAGAAGGTATACGG - Intronic
951473688 3:23082346-23082368 GTTCAAATGCAGAAGGTCCATGG + Intergenic
952020093 3:29008298-29008320 TTTTAGATTCAGGAGGTACATGG - Intergenic
952164133 3:30727945-30727967 CTTAGAATCCAGAACCTACATGG + Exonic
952533589 3:34287626-34287648 GTTAAAATTCAGATGGTACCAGG + Intergenic
956809037 3:72846669-72846691 CTTAAAATTCAGCAGGCTCTGGG + Intronic
956978016 3:74604422-74604444 GTTAATATTCAGAATGTATAAGG + Intergenic
957494268 3:80970088-80970110 CTTAAAATTCTGAAAGGAAATGG - Intergenic
957572390 3:81963956-81963978 CTTAAAATTTAGAAAGGAAAAGG - Intergenic
958687676 3:97420927-97420949 CTTAACATTCAGCAGATAAAAGG + Intronic
959078556 3:101777107-101777129 CTTAATTTTCAGTAGGTAGATGG + Intergenic
959161326 3:102728494-102728516 CTTAGAATTCACAAGGTATACGG + Intergenic
959327992 3:104962303-104962325 CTTAAAACTCTGAAGCTTCATGG + Intergenic
959343308 3:105159266-105159288 CTTACAATTTTGAAGATACATGG - Intergenic
961336438 3:126182658-126182680 GTTAAAATTGAGAAGGCAGATGG + Intronic
961407820 3:126694504-126694526 TTTTAGATTCAGGAGGTACACGG + Intergenic
962639680 3:137372181-137372203 ATTAATATTCAGAATCTACAAGG - Intergenic
964696429 3:159512976-159512998 CTTAAAATACAGCAGGTGAATGG + Intronic
964989665 3:162793142-162793164 GTTTAAATTCAGAAGGAATATGG + Intergenic
966569021 3:181419543-181419565 CTTTAAATTTAGAAAGTAAAAGG + Intergenic
967056299 3:185831803-185831825 CTTAAAATTCTGATGGTTCAAGG + Intergenic
967944246 3:194790110-194790132 ACTAAAATTCAGAATATACAAGG - Intergenic
970329990 4:14971215-14971237 ATTAATATTCAGAATATACAAGG + Intergenic
970783023 4:19761919-19761941 CTTAGAATCCAGAATATACAAGG - Intergenic
971721346 4:30248744-30248766 ACTAATATTCAGAACGTACAAGG - Intergenic
972567138 4:40279733-40279755 CTAGAAATTAAGCAGGTACAGGG + Intergenic
972910438 4:43809833-43809855 ATTAAAATACAGTAGTTACAAGG - Intergenic
973025495 4:45264462-45264484 CGTAAAAATCAGCAGGTATACGG - Intergenic
973339258 4:48986851-48986873 TTTAAAATTCAGAAGGAAAGGGG + Intronic
974498167 4:62660649-62660671 CTTTAATTTCAATAGGTACAGGG + Intergenic
974732165 4:65881643-65881665 CTGAAAATTCTGCAGATACATGG + Intergenic
974774441 4:66461844-66461866 ATTAAAATTCAGGAAATACAGGG - Intergenic
975104803 4:70555505-70555527 GTTAATATTCAGAATCTACAAGG + Intergenic
975840097 4:78464712-78464734 ATTAAAATACAGAAGATACCAGG + Intronic
976948049 4:90794658-90794680 TTTAAAATTCAAATGGAACAAGG - Intronic
977068605 4:92352396-92352418 ATTAATATCCAGAAGATACAAGG - Intronic
977461066 4:97325914-97325936 TCTAAAATTCAGAATTTACAAGG - Intronic
977983965 4:103360325-103360347 CCTAAATTTCAGAAGATATATGG + Intergenic
978408648 4:108405687-108405709 CCTAAATTTCAGAAGATGCATGG - Intergenic
978479886 4:109176907-109176929 CCTAGAGTTCAGAAGGAACATGG + Intronic
979295735 4:119030916-119030938 TTCAAAATTCAGAAGGCAAACGG + Exonic
979406457 4:120317058-120317080 GTTTGTATTCAGAAGGTACAGGG + Intergenic
980185114 4:129451321-129451343 CCTAATATTCAGAATATACAAGG + Intergenic
981437336 4:144740851-144740873 CTTAAACTTGAGAATGGACAAGG - Exonic
981539241 4:145831765-145831787 CTTAAAATGCAGGAGGAAAAAGG + Intronic
981595387 4:146415332-146415354 CTTGAGATTCAGAAAGTTCAAGG - Intronic
981713372 4:147731029-147731051 CTTAAAATACAAAAAGTACCCGG - Intergenic
982502941 4:156181029-156181051 CTTATAAATCAGAAGGAAAAGGG + Intergenic
982714517 4:158792807-158792829 CTTAGAATGGAGAAGGTAAATGG + Intronic
982931481 4:161413172-161413194 CTTAATATTCAGAATCTATAGGG + Intronic
983003691 4:162454930-162454952 ATTAAAAGTCAGAAGTTTCAGGG - Intergenic
983303931 4:165962187-165962209 CCTAATATTCAGAATGCACAAGG + Intronic
983321855 4:166204979-166205001 CTTAAATTTAAGATGGGACAAGG + Intergenic
983595780 4:169465675-169465697 TTTATAATTCACAAGGCACAAGG + Intronic
983785916 4:171729302-171729324 CCTAGATTTCAGAAGGTATATGG + Intergenic
983851217 4:172582975-172582997 CTTGAAATTGAGAAAGTACAGGG + Intronic
985617090 5:929578-929600 CCTAGATTTCAGAAGATACATGG + Intergenic
986113928 5:4750596-4750618 CTTAGATTTCAGAAGATGCATGG - Intergenic
986378119 5:7153916-7153938 CCTAATATCCAGAATGTACAAGG - Intergenic
986549511 5:8936735-8936757 CATAAAATTCAGAATCTAGATGG + Intergenic
986718475 5:10540933-10540955 TTTAAAATGCAGATGGTACAGGG + Intergenic
987741142 5:21910304-21910326 CATCAAATTCAGAAGCTCCAAGG + Intronic
988148430 5:27342789-27342811 ATTAAAATTTTGAAGCTACATGG + Intergenic
988199920 5:28054685-28054707 CCTAGAGTTCAGAAGATACATGG - Intergenic
988373126 5:30398432-30398454 CTCAAAATGCATAAGGTACAAGG + Intergenic
988647047 5:33105974-33105996 ACTTAAATTCAGAAGGTAAATGG - Intergenic
988649423 5:33131877-33131899 CCTAGATTTCAGAAGGTATATGG + Intergenic
989499732 5:42151405-42151427 CCTAATATTCAGAATCTACAAGG - Intergenic
989796722 5:45483500-45483522 CTTAATATCCAGAATCTACAGGG - Intronic
990281155 5:54252452-54252474 CTGAAACTTCAGAAAGTCCAGGG - Intronic
993145996 5:84094799-84094821 TTAAAAATGCAGAAGGTATATGG + Intronic
993438391 5:87925352-87925374 CTGAAAATTCAGTAGCTCCATGG - Intergenic
995379308 5:111513960-111513982 CATAAAATTCAGATGGTGCTTGG + Intergenic
995878292 5:116815497-116815519 CTTAAATTTCAGCCGTTACATGG - Intergenic
996698716 5:126426997-126427019 CATAAAATTCAGAATGAAAAAGG - Intronic
998305108 5:141068361-141068383 CATAACATTCACAAGGTCCAAGG + Intergenic
999053747 5:148551553-148551575 ATTAATATTCAGAAGCTATAGGG + Intronic
999903021 5:156107351-156107373 CATAAATTGCAGAAGGTTCACGG + Intronic
1000893349 5:166825889-166825911 GCTAATATTCAGAAGGCACAGGG - Intergenic
1000990175 5:167903764-167903786 ATCAAAATTCAGAAGGTCTAAGG - Intronic
1001966757 5:175914960-175914982 ACAAAAATTCAGAAGGCACAAGG - Intergenic
1002250192 5:177924244-177924266 ACAAAAATTCAGAAGGTACAAGG + Intergenic
1002973759 6:2052347-2052369 CTTAAATATCAGAAAATACAGGG - Intronic
1004797856 6:19108930-19108952 TTTAAAATTCAAAATATACAAGG - Intergenic
1005132913 6:22532314-22532336 CTTTAACTTCAGAAGGAACATGG + Intergenic
1008084807 6:47233309-47233331 TTTAGAATTCAGAAGGTGAATGG + Intronic
1008226808 6:48929321-48929343 CATAAAATTAAAAAGTTACACGG + Intergenic
1008449214 6:51630759-51630781 TATAAAATACAGAAGGTATAAGG + Intronic
1008738177 6:54572780-54572802 ATTAATATTCAGAATCTACAAGG - Intergenic
1009936810 6:70244060-70244082 TTCAAAATTCAGAAGGTTTATGG - Intronic
1010569313 6:77458829-77458851 CTTAAAATACAGGAGGAACTGGG - Intergenic
1010821165 6:80417847-80417869 ATTCAAATTCAGAAAATACAGGG - Intergenic
1011181038 6:84621137-84621159 GTTAATATTCAGAATGTATAAGG - Intergenic
1014833725 6:126133132-126133154 ATGAAAATTGAGAATGTACAAGG + Intergenic
1016619340 6:146090114-146090136 CTTCACACACAGAAGGTACATGG - Intronic
1016820233 6:148340182-148340204 CTTAAATTTAAGAAAGTACCAGG + Intronic
1017231359 6:152077312-152077334 CTTATATTTCAGAAGATACGTGG + Intronic
1018375386 6:163205823-163205845 CCTAAAATTCAGAATCTATAAGG + Intronic
1018493443 6:164321702-164321724 CTTCCCATTCAGAAGGTTCACGG - Intergenic
1018559449 6:165086215-165086237 TTTTAAATTCAGAGGATACATGG - Intergenic
1020836630 7:13161254-13161276 CTTTGTATTCAGAAGGTACCAGG + Intergenic
1020992763 7:15221172-15221194 CTCAATATCCAGAAGGTAAAAGG - Intronic
1021159136 7:17250124-17250146 ATTAATATTCAGAATCTACAAGG - Intergenic
1022397050 7:29998561-29998583 ATTAATATTCAGAATATACAAGG - Intergenic
1022790990 7:33689028-33689050 CTTCAAATTCAAAAAGTCCAAGG + Intergenic
1022885066 7:34634513-34634535 ATTCAAATTCAGGAAGTACATGG + Intergenic
1023270771 7:38459953-38459975 AATAATATTCAGAATGTACAAGG + Intronic
1023409270 7:39872504-39872526 CTTAAAATTCAGAAAAAAAAGGG - Intergenic
1023524401 7:41084142-41084164 TTTAAAATTCATACGTTACAGGG + Intergenic
1024186992 7:46959587-46959609 ATTATAATTCAAAAGGTCCAGGG + Intergenic
1024488854 7:49953441-49953463 CTCAAAATTCAAAAGGCACTGGG + Intronic
1024818587 7:53300438-53300460 CTTAAAATTAATTATGTACATGG + Intergenic
1025043663 7:55671526-55671548 CTTAAAATTCAGAAAAAAAAGGG + Intergenic
1025136585 7:56420031-56420053 CTTAAAATTCAGAAAAAAAAGGG + Intergenic
1026962601 7:74418064-74418086 GTGTAAATTCAGAAGGAACATGG + Intergenic
1027554525 7:79647436-79647458 CTTAAAATTCAGAATCTGGATGG - Intergenic
1027910262 7:84241484-84241506 CTTAATATCCAGAATCTACAAGG - Intronic
1027925749 7:84461069-84461091 CTTAAAATTCATAGGGTATAAGG + Intronic
1028057405 7:86263478-86263500 CTTAAAATTTAGCAAGTATATGG - Intergenic
1028234334 7:88342343-88342365 CTTAAAATTATGAATGTTCAAGG - Intergenic
1028520550 7:91725730-91725752 ATTAATATTCAGAATATACAAGG + Intronic
1028648244 7:93121472-93121494 CTGAAAGGTCAGAAGGTCCAGGG - Intergenic
1030778697 7:113569759-113569781 GTTAAAAATCAGAAGTTCCAGGG + Intergenic
1030919373 7:115361991-115362013 GTTAATATTCAGAATTTACAAGG - Intergenic
1031166758 7:118238718-118238740 ATTAAAATTCAGAAGCCATATGG + Intronic
1031334282 7:120507708-120507730 CTGAAAATTCAGGAGGTGTAGGG - Intronic
1032555017 7:132823811-132823833 CTAAGAATTCACAAGGTACCAGG - Intronic
1033792971 7:144814729-144814751 CTTCTAATTTAGATGGTACATGG - Intronic
1033822894 7:145155375-145155397 GTTAAAATTTAAAAAGTACAGGG + Intergenic
1035471223 7:159110139-159110161 CTTAAAATTCAGAAGGTACATGG - Intronic
1035561430 8:607097-607119 CTTGAAAACCAGAATGTACAAGG - Intergenic
1036960092 8:13235352-13235374 CTTAAAATTCAGGAAATACAAGG + Intronic
1037414051 8:18629869-18629891 CTTACAATCCAGAATGTGCATGG - Intronic
1038227593 8:25670975-25670997 CTTTAAAATCAGAATGTACTTGG - Intergenic
1038362341 8:26893410-26893432 ATTAAAAACCAGAATGTACAAGG - Intergenic
1039515146 8:38126416-38126438 CTTAATTTTAAGAAGGTCCATGG + Intronic
1041316301 8:56566262-56566284 CTGAAAAATCACAAAGTACAAGG - Intergenic
1042682410 8:71400408-71400430 TCTAATATCCAGAAGGTACAAGG + Intergenic
1045988325 8:108276338-108276360 CTTGAAATTTTCAAGGTACAGGG - Intronic
1046678154 8:117135459-117135481 CCTACAATTCAGAAGCAACAAGG - Intronic
1047121743 8:121912428-121912450 TTTAATATTCAGAATCTACAAGG + Intergenic
1048347904 8:133591798-133591820 CTTAAACTGCAGCAGGTAAAGGG - Intergenic
1049120058 8:140728411-140728433 CTGAAAATCCAGAAGGGACCTGG - Intronic
1050117121 9:2274722-2274744 TTGAAAATTCAGAAGCTACCTGG + Intergenic
1051254632 9:15200835-15200857 CTAAAAATTCAGAAAGTAGCCGG + Intronic
1051652121 9:19338338-19338360 CTTAAAAATCTGAAGGAATAAGG - Intronic
1052266584 9:26580629-26580651 ATTAAAATTCAGAATATACAAGG + Intergenic
1052393086 9:27904214-27904236 CTTAAAATTCATAAGGAAACAGG + Intergenic
1052504568 9:29336471-29336493 TTTAAAATTCAGAAAGAACTGGG + Intergenic
1052565791 9:30149382-30149404 CTTAAAACTCAGAACTTAAAAGG + Intergenic
1052783624 9:32807271-32807293 GTTAAATTTTAGAAGTTACAAGG - Intergenic
1052931616 9:34060356-34060378 CTGAAAATTCAGTAGATAAATGG + Intergenic
1053641664 9:40088216-40088238 CTTAGATTTCAGAAGATATATGG - Intergenic
1053764472 9:41377248-41377270 CTTAGATTTCAGAAGATATATGG + Intergenic
1054322554 9:63685605-63685627 CTTAGATTTCAGAAGATATATGG - Intergenic
1054543087 9:66288425-66288447 CTTAGATTTCAGAAGATATATGG + Intergenic
1054771098 9:69084793-69084815 CTAAAAATTCAAAAGTTAGATGG + Intronic
1055430139 9:76235091-76235113 CTTAAAATACAGCAGAAACAAGG - Intronic
1056515945 9:87350226-87350248 GTTAATATTCAAAATGTACAAGG + Intergenic
1057418410 9:94886504-94886526 TTTAAAATTCAGAATATAAATGG + Intronic
1057488172 9:95502298-95502320 CCAAACATTCAGCAGGTACACGG - Intronic
1060933126 9:127501192-127501214 CCTCAAATTCTGCAGGTACAGGG + Intronic
1202789442 9_KI270719v1_random:71302-71324 CTTAGATTTCAGAAGATATATGG - Intergenic
1185514713 X:690844-690866 CTGAAAATACAGACGGGACACGG - Intergenic
1186941518 X:14513526-14513548 ATTAATATTCAGAATGCACAAGG + Intergenic
1188318806 X:28709821-28709843 CTTAAAATTTAAAAAGTACATGG + Intronic
1190896764 X:54626894-54626916 ATGAAAATTCAGAATATACAAGG - Intergenic
1191928174 X:66338756-66338778 CTTAATATCCAGAATCTACAAGG - Intergenic
1191936882 X:66436483-66436505 CTTAAAATTCTCAAGGGAAAAGG + Intergenic
1192810378 X:74542024-74542046 CTTCAAGTTCAGAATGTGCATGG - Intergenic
1193513916 X:82439773-82439795 CTTAAAATACAGAACTTAAAAGG + Intergenic
1193558070 X:82981403-82981425 CCTATAATTCAGAAGCTACCAGG + Intergenic
1194501050 X:94681252-94681274 ATTAAAATGGAGAAAGTACATGG - Intergenic
1194579959 X:95659830-95659852 CTTAAAATTCATATGTTACAAGG + Intergenic
1195603334 X:106773491-106773513 CTTAGAAATTAGAAAGTACACGG + Intronic
1196315553 X:114218699-114218721 GTTAAAATTTAGAGGGTATAGGG + Intergenic
1197013216 X:121592446-121592468 TTTAAAATTCAGAATTTGCAAGG + Intergenic
1197624038 X:128782515-128782537 CATAGAATTCAGAATCTACATGG + Intergenic
1197994115 X:132353927-132353949 CTAAAAATTCAAAAGGTAGATGG - Intergenic
1198061866 X:133053980-133054002 CAGAAAAGTCAGAAAGTACAAGG + Intronic
1198322833 X:135536195-135536217 GTGAAAATTCATAACGTACAAGG + Intronic
1199106581 X:143875828-143875850 CTTAGATTTCAGAAGATGCATGG + Intergenic
1199237772 X:145510541-145510563 CCTAGAATTCAGAAGATATATGG + Intergenic
1199403394 X:147427098-147427120 TTTAAACTTCAGAAGGGACTAGG + Intergenic
1199993618 X:153004728-153004750 CTTAGATTTCAGAAGATGCATGG - Intergenic
1201769256 Y:17602738-17602760 CTGGAAATTCATAAGGTCCAGGG - Intergenic
1201832298 Y:18303247-18303269 CTGGAAATTCATAAGGTCCAGGG + Intergenic