ID: 1035472212

View in Genome Browser
Species Human (GRCh38)
Location 7:159117687-159117709
Sequence CCCTCAGCTGCCACTCTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 389
Summary {0: 1, 1: 2, 2: 1, 3: 32, 4: 353}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035472212_1035472219 5 Left 1035472212 7:159117687-159117709 CCACAGAGAGTGGCAGCTGAGGG 0: 1
1: 2
2: 1
3: 32
4: 353
Right 1035472219 7:159117715-159117737 GGCCCAGGAGGCCCGAGTCATGG 0: 1
1: 0
2: 5
3: 26
4: 281
1035472212_1035472217 -10 Left 1035472212 7:159117687-159117709 CCACAGAGAGTGGCAGCTGAGGG 0: 1
1: 2
2: 1
3: 32
4: 353
Right 1035472217 7:159117700-159117722 CAGCTGAGGGTGGGTGGCCCAGG No data
1035472212_1035472218 -7 Left 1035472212 7:159117687-159117709 CCACAGAGAGTGGCAGCTGAGGG 0: 1
1: 2
2: 1
3: 32
4: 353
Right 1035472218 7:159117703-159117725 CTGAGGGTGGGTGGCCCAGGAGG 0: 1
1: 0
2: 5
3: 33
4: 490
1035472212_1035472220 6 Left 1035472212 7:159117687-159117709 CCACAGAGAGTGGCAGCTGAGGG 0: 1
1: 2
2: 1
3: 32
4: 353
Right 1035472220 7:159117716-159117738 GCCCAGGAGGCCCGAGTCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035472212 Original CRISPR CCCTCAGCTGCCACTCTCTG TGG (reversed) Intronic
900396059 1:2453704-2453726 CTCTCTGCTGCCTCTTTCTGGGG + Intronic
901604846 1:10451011-10451033 TTCTCAGCTGCCAGTCACTGAGG + Intronic
901954287 1:12772731-12772753 CCCACAGCTTCCACCCTCTGTGG + Intergenic
902210604 1:14901792-14901814 CCCACAGCTGCCTCTCTCTGGGG + Intronic
903043726 1:20551335-20551357 CCCACTGCTCCCACTCTCGGAGG + Intergenic
903066563 1:20702955-20702977 CCCTGAGCTGCTCCTCTGTGTGG - Intronic
903786122 1:25862512-25862534 CCTTCCACTGCCACTCACTGGGG - Exonic
904467993 1:30719251-30719273 CCCTCAGCCGCCTCAGTCTGAGG - Intronic
905519686 1:38588471-38588493 GCCTCAGCTGGCAGTCTCCGAGG - Intergenic
905863969 1:41366819-41366841 CCCCCAGCCCCCACTTTCTGCGG + Intronic
907276654 1:53320531-53320553 CCCTGGGCTGACACTCCCTGAGG + Intronic
907329468 1:53661716-53661738 CTCTATGCTGCCCCTCTCTGGGG + Intronic
907542879 1:55232693-55232715 CCCTCTGCTGTCTGTCTCTGTGG + Intergenic
909014468 1:70367950-70367972 CCCTTCGCTGACACTCTCTTTGG + Exonic
910165780 1:84325946-84325968 TCCACAGCTGCCACTGTCTCCGG - Intronic
910807488 1:91203438-91203460 AGCTCAGCTGCCATTCCCTGTGG - Intergenic
911300189 1:96163389-96163411 CCCTCTTCTGCAACCCTCTGAGG - Intergenic
913335077 1:117702526-117702548 CACACAGCTTCCTCTCTCTGTGG + Intergenic
915003091 1:152611501-152611523 CCCTCAGCTGCCAATGACTCAGG + Intergenic
915358446 1:155270930-155270952 CCCCCGGCTGCCTCGCTCTGAGG + Exonic
915590273 1:156866641-156866663 CCCTCAGATCCCCCTCCCTGGGG + Intronic
917793270 1:178513424-178513446 GCCTCTGCTGCCTCCCTCTGGGG + Intronic
919377181 1:196809029-196809051 GCCTCAGCTGCCTCCCTGTGGGG + Intergenic
919386892 1:196933930-196933952 GCCTCAGCTGCCTCCCTGTGGGG + Intronic
920507560 1:206527267-206527289 CGCTCTGGTGCCAATCTCTGAGG + Intronic
920695637 1:208179612-208179634 CCCTCATCTGCCCCACCCTGTGG - Intronic
921758306 1:218883817-218883839 ACCTCAGTGGCCACTCTGTGTGG + Intergenic
923039306 1:230308509-230308531 CCACCAGCTGCCCCTCTTTGTGG - Intergenic
923148724 1:231215624-231215646 CTCACAGCTGCCACTGTCAGTGG + Exonic
923377654 1:233380454-233380476 CCCTCAGATGTCACTGTATGTGG - Intronic
924183059 1:241458573-241458595 CCATCTGGGGCCACTCTCTGTGG - Intergenic
1062930326 10:1348534-1348556 CCCTCGGCTGCCTCCATCTGAGG + Intronic
1062945097 10:1454633-1454655 CCCTCTGCTTCCTGTCTCTGTGG - Intronic
1064059749 10:12128162-12128184 ACCCCAGCTGCCACGCTGTGAGG + Intergenic
1064280560 10:13947438-13947460 CACTCAGTTACCCCTCTCTGTGG + Intronic
1064328459 10:14372539-14372561 TCCTCTGCTGCCACTCTCCCTGG + Intronic
1066022006 10:31313085-31313107 GCTTCAGCTGCCATTCTCTTAGG - Intergenic
1066149235 10:32597749-32597771 CCGTCAGCTGCCGGTCTCTTGGG + Intronic
1066615043 10:37285308-37285330 GCCTCAGCTGCCTCCCTGTGGGG - Intronic
1067409708 10:46053636-46053658 TCCTCAGCTCCCTCTATCTGAGG - Intergenic
1067528910 10:47056174-47056196 CTCTCAGCTGCCTCTGTCAGGGG + Intergenic
1067684249 10:48457511-48457533 CCCTCAGCTGCTATCCTTTGAGG - Intronic
1069724348 10:70567607-70567629 CCCTCAGCTAGCACTCCTTGGGG - Exonic
1070895988 10:79983175-79983197 CCCTCAGCTTCAACTGGCTGGGG + Intergenic
1072278502 10:93845367-93845389 GCCTTAGCTGCCTCCCTCTGGGG + Intergenic
1072719315 10:97771102-97771124 CACTATGCTGCCACTCCCTGGGG + Intronic
1074576368 10:114673542-114673564 CCCTCTGCAGGCAGTCTCTGTGG + Intronic
1074693552 10:116028271-116028293 TCCCCAGCTGCCATTGTCTGGGG - Intergenic
1075573050 10:123559133-123559155 ACCTCCTCTGCCACCCTCTGAGG - Intergenic
1076727848 10:132421691-132421713 GCCTCACCCGCCTCTCTCTGCGG - Intergenic
1076767933 10:132646746-132646768 CACAAAGCTGCCACACTCTGTGG + Intronic
1077021934 11:420830-420852 CCCACAAGTGCCGCTCTCTGCGG - Exonic
1077996115 11:7453960-7453982 CCTTCAGCAGGCACCCTCTGTGG + Intronic
1078066495 11:8082302-8082324 CCCTCTGCTGCCAGGCACTGTGG + Intronic
1078575377 11:12497660-12497682 CCCTCAGGTGTCTCCCTCTGCGG - Intronic
1079364520 11:19797719-19797741 CCCTACTCTGCCACTCTGTGTGG + Intronic
1080172209 11:29318433-29318455 CCCTCAGATACAGCTCTCTGGGG + Intergenic
1083882948 11:65557530-65557552 CCCTCAGCCCCCAGTCTCTAAGG + Intronic
1084149266 11:67280639-67280661 CACCCAGCCGCCACTCCCTGGGG - Intronic
1084477510 11:69397219-69397241 CCTGCAGCTCCCACTCTCGGGGG + Intergenic
1084593911 11:70105964-70105986 CTCTCAGCTGCCCCTGCCTGGGG - Intronic
1084813623 11:71631735-71631757 GCCTTAGCTGCCTCTCTGTGGGG - Intergenic
1085984609 11:81770295-81770317 CCCTTAGCTGACTCTCTTTGTGG + Intergenic
1085986426 11:81793451-81793473 CTCTGTCCTGCCACTCTCTGAGG - Intergenic
1086424335 11:86669494-86669516 CTCTCTCCTGCCACCCTCTGAGG - Intronic
1088929904 11:114341026-114341048 CCTGCAGCTGCCACTCGGTGGGG - Intergenic
1089244712 11:117110594-117110616 GCCTCAGCTGCCTCCCTGTGGGG - Intergenic
1090188990 11:124756280-124756302 CCCTGAGCTGCCAGTCTCCAAGG - Exonic
1090193208 11:124791565-124791587 CCCTGAGCTGCCAGTCTCCGAGG + Intronic
1090586168 11:128215413-128215435 GCCTCAGCTGCCTCTCCATGGGG - Intergenic
1091124640 11:133083306-133083328 CTCTGAGCTGCCCCTCTCCGAGG + Intronic
1091624902 12:2114280-2114302 CCCTGAGCTGCCATGCTGTGAGG - Intronic
1092263222 12:6963306-6963328 TCCCCAGCACCCACTCTCTGGGG + Intergenic
1092658533 12:10714095-10714117 CCAGCACCTGCCACTCTGTGAGG - Intronic
1092839105 12:12521842-12521864 TCCTCAGCTGCCATTCTTTGTGG - Intronic
1093583257 12:20807582-20807604 GCCTCAGCTGCCTCCCCCTGGGG - Intergenic
1094108805 12:26839391-26839413 GCCTCAGCTGCCTCCCTGTGGGG + Intergenic
1094151844 12:27293577-27293599 CCCTCAGCTGCCAGTGTCTCAGG - Intronic
1095662239 12:44750638-44750660 TTCTCAGCTGCCACTCTCCCAGG + Intronic
1096180970 12:49550142-49550164 CCTGCAGCTGCCACTGTTTGAGG + Exonic
1096700543 12:53380277-53380299 CCCTCAGCTGCCACCATGAGCGG + Exonic
1097044348 12:56176326-56176348 TCCACAGCTTCCCCTCTCTGGGG - Intronic
1099190186 12:79554147-79554169 GCCTCAGCTGCCTCCCTGTGGGG - Intergenic
1101528135 12:105550137-105550159 CTCAGAGCTGCCACTCCCTGAGG - Intergenic
1101732115 12:107435376-107435398 CTCCCACCTGTCACTCTCTGTGG + Intronic
1101885537 12:108658013-108658035 TCCTCATTTGCCACACTCTGAGG - Intronic
1102536810 12:113587913-113587935 CCCTCACTTACCTCTCTCTGTGG + Intergenic
1103210712 12:119164344-119164366 CCCTCACCTGTCAGTCCCTGGGG - Intergenic
1104993756 12:132641631-132641653 CCTTCAGGTGCCACCCTCTCTGG - Exonic
1105348550 13:19596264-19596286 CGCTCAGCTGCTACACTGTGCGG - Intergenic
1105820149 13:24073481-24073503 GCCTCAGCTGCCACTGTCACAGG - Intronic
1105843083 13:24272352-24272374 CCCTCACCTGCCTCTCTGAGAGG + Intronic
1107415944 13:40200178-40200200 ACCTCACCTGCCTCACTCTGGGG - Intergenic
1108686755 13:52826479-52826501 GCCTCAGCTGCCACCCTATGGGG + Intergenic
1109140400 13:58707769-58707791 CCCTCAGCGGCCACCCACTTGGG - Intergenic
1112646058 13:101333413-101333435 CCCTCAGCTCTCACTCCCTTAGG - Intronic
1113762512 13:112859503-112859525 CCCACAGCAGCCACCCACTGCGG - Intronic
1113881321 13:113628434-113628456 CCCTCACCCGCCTCTCGCTGGGG - Intronic
1114288737 14:21270313-21270335 CCGTCACCTGCCAGTCTCTCTGG + Intergenic
1114603001 14:23970861-23970883 CCCTCAGCTGCAGGTCTTTGGGG - Intronic
1114607362 14:24007987-24008009 CCCTCAGCTGCAGGTCTTTGGGG - Intergenic
1114679581 14:24473327-24473349 GCCTCAGCTGCCTCTCCGTGGGG + Intergenic
1117714040 14:58562750-58562772 CCCCCAGCTGCTCCTCTCTGAGG - Intergenic
1119134398 14:72203670-72203692 CTCTCAGATTCCCCTCTCTGGGG - Intronic
1119631528 14:76236495-76236517 CCCTCATCTGTCATGCTCTGGGG + Intronic
1120858015 14:89229742-89229764 CCCTCTGGTGACACTCGCTGAGG + Intronic
1121666372 14:95675506-95675528 CCCTCTGCTGCCTCTCCCTCTGG - Intergenic
1121744331 14:96276219-96276241 CCCTCAACTCCCACTCTTTCAGG - Exonic
1121947246 14:98135353-98135375 TCCAAAGCTGGCACTCTCTGGGG + Intergenic
1123106704 14:105845172-105845194 CCCTCCGCTCCCTCTCTCTGAGG - Intergenic
1202881859 14_KI270722v1_random:67825-67847 CCAGCACCTGCCACTGTCTGCGG - Intergenic
1123700845 15:22913862-22913884 CAGTCACCTTCCACTCTCTGTGG - Intronic
1123862971 15:24486847-24486869 CCCTCCGCTCCCTCTCTGTGGGG + Intergenic
1126676144 15:51160628-51160650 CACTCAGCTGCCAGTCCCCGAGG - Intergenic
1127038243 15:54943853-54943875 CCCTTATCTGCCAGTCTTTGTGG - Intergenic
1127275434 15:57439274-57439296 CCCGCAGCGGCCACTGTCTCAGG + Exonic
1127833345 15:62770073-62770095 CTCTCAGCTGCCACAGTCTGTGG - Intronic
1128528481 15:68428559-68428581 CCCTCAGCTGCCATTAGCTGAGG - Intronic
1128808994 15:70556248-70556270 CCCGCTGCTCCCACTCTCTCAGG + Intergenic
1129937210 15:79460653-79460675 TCCTAAAATGCCACTCTCTGTGG + Intronic
1129973070 15:79797278-79797300 CCCTAACCTGACAGTCTCTGGGG + Intergenic
1130077730 15:80704243-80704265 TCTCCAGCTGCCTCTCTCTGGGG + Intronic
1130289994 15:82590493-82590515 CTTTCAGCAGTCACTCTCTGGGG + Intronic
1130302151 15:82688554-82688576 AGCCCAGCTTCCACTCTCTGAGG + Intronic
1130377936 15:83346676-83346698 CCATCAGCTCCTCCTCTCTGGGG + Intergenic
1130938836 15:88491257-88491279 CCAGCAGCTGCCACCCTCAGAGG - Intergenic
1131122896 15:89834087-89834109 CCCTCAGGTGCCATTCTCCCAGG - Exonic
1131872673 15:96777993-96778015 CTCTCTGCTGTCACTCTTTGTGG - Intergenic
1132157233 15:99504197-99504219 TCCTCAGCTTCCCCTTTCTGAGG + Intergenic
1132733657 16:1375257-1375279 CGCTCAGCAGCCACACTGTGTGG + Intronic
1132817400 16:1838106-1838128 CCCTCAGCTTCCCGTTTCTGAGG + Exonic
1132880908 16:2161265-2161287 CCCTCAGCTGGCGCTCGATGGGG + Intronic
1133065056 16:3200067-3200089 CCCTCAGTTCCCTCTCTCTCAGG - Intergenic
1134257920 16:12626703-12626725 CCCTGAGCTGCCACTCATTCGGG - Intergenic
1135952910 16:26931839-26931861 TCCTCAGCTCCCACTCACTGGGG - Intergenic
1136569761 16:31089531-31089553 CCCACAGCTGCCTCTGTCTTGGG - Intronic
1137335632 16:47546342-47546364 CCCTCAGCTGCAGCTCTGTTGGG + Intronic
1138434574 16:56989854-56989876 CCCTCATCTGCCATCCTCTGCGG - Intronic
1139571646 16:67816629-67816651 TTCTCAGCTGCCACCTTCTGTGG + Intronic
1139914232 16:70418418-70418440 CCCTGGGATGCCAGTCTCTGAGG - Intronic
1140548514 16:75836569-75836591 CCCTTATCTTCCAGTCTCTGTGG + Intergenic
1140703352 16:77603074-77603096 CACTCAGAAGCAACTCTCTGAGG - Intergenic
1140933942 16:79653466-79653488 CCCTCATCAGCCACTCTCCCAGG - Intergenic
1141119438 16:81340520-81340542 CCCTCAGCTGCAGGTCTGTGGGG - Intronic
1143334036 17:6159131-6159153 CCCTGAGCTTCCCATCTCTGAGG - Intergenic
1145880343 17:28348303-28348325 CCCTCAGCTGCCAGCCACAGAGG + Intronic
1146469121 17:33110460-33110482 GCCCCATCAGCCACTCTCTGAGG - Intronic
1146952854 17:36918816-36918838 CCCTGACCTGCCACTCCATGAGG + Intergenic
1147040734 17:37716658-37716680 CCCTGAGCAGCTCCTCTCTGGGG - Intronic
1147138963 17:38451080-38451102 CCCTCCGCCACCACCCTCTGGGG + Intronic
1147763928 17:42820180-42820202 CCCACAGCTGCCAGTCACTGGGG - Intronic
1148124097 17:45228129-45228151 CCATCAGATGCCACTCACTCGGG - Intronic
1148152316 17:45404173-45404195 TGCTCAGCTGCCACTCTCTATGG + Intronic
1148824711 17:50384048-50384070 CCCTCACCTGCCTCTCCCTCAGG + Intronic
1148875515 17:50684669-50684691 GCCTAAGCTGCCTCCCTCTGAGG + Intronic
1150656695 17:67044276-67044298 CCCTGAGCTGCTACTCACAGAGG + Intergenic
1151080545 17:71324234-71324256 CATTCAGGTGCCCCTCTCTGTGG + Intergenic
1151158336 17:72143123-72143145 CCCTTAGCTACCACACTGTGTGG + Intergenic
1152312918 17:79561769-79561791 CCCTCATGTGCCCCTCTCTTGGG - Intergenic
1152992848 18:378512-378534 CCCTCAGTGGCCACACCCTGTGG - Intronic
1153415403 18:4840797-4840819 CCCTCAGCTGGGACCCTCTCTGG + Intergenic
1154428722 18:14291996-14292018 CCAACAGCTCACACTCTCTGTGG - Intergenic
1155301759 18:24435851-24435873 CCCTTATCTTCCAGTCTCTGTGG - Intronic
1155417606 18:25616783-25616805 CACTCAGCTGACTCTCTCTGCGG - Intergenic
1156890791 18:42187284-42187306 CCTGGGGCTGCCACTCTCTGTGG + Intergenic
1157282704 18:46356659-46356681 CCTTCAGCTGCCTGTGTCTGGGG - Intronic
1157975272 18:52319782-52319804 TCCCCAGAGGCCACTCTCTGTGG - Intergenic
1158284213 18:55861453-55861475 CCCTCTGCTGGCTGTCTCTGAGG + Intergenic
1160232122 18:77056500-77056522 CCCTCAGCTCCCAGTCCCTGCGG + Intronic
1160715236 19:573321-573343 CCCTCCCCTGAGACTCTCTGGGG + Intronic
1160972584 19:1776057-1776079 AACTGAGCTGCCCCTCTCTGCGG + Exonic
1161276965 19:3423793-3423815 CCCTCAGCCTCCTCTCTCTGGGG + Intronic
1161418905 19:4164619-4164641 CACTCAGCTGCCCCTCACTAAGG + Exonic
1161840998 19:6680248-6680270 CCCTCAGGTCTCACACTCTGAGG - Exonic
1163174828 19:15556976-15556998 ACCCCAGCTCCCTCTCTCTGGGG + Intergenic
1163706314 19:18815709-18815731 CCCTCATGTATCACTCTCTGGGG + Intergenic
1164199217 19:23002983-23003005 CCAGCGGCTGCCACTCTCTCGGG + Intronic
1164577311 19:29413131-29413153 GGCTGAGCTGCCACTCTCTTTGG + Intergenic
1165846602 19:38821715-38821737 GCCTCAGCTGCCTCCCTGTGGGG + Intronic
1166754783 19:45183986-45184008 CACTAAGCTGCCACTCTCCCAGG - Intronic
1167118668 19:47503357-47503379 CCCTCAGCTTCCACTCACACAGG - Intronic
1167688578 19:50971327-50971349 CCCTCTGCCTCCTCTCTCTGGGG + Intergenic
1168589333 19:57619504-57619526 CCCTCAGCTCCCACTCACCAGGG - Exonic
1168597062 19:57685816-57685838 TCCCCAGCTGCCACTCACTGGGG - Intronic
1202657467 1_KI270708v1_random:36924-36946 CCAGCACCTGCCACTGTCTGCGG - Intergenic
925069511 2:955915-955937 CCCACATCTGCCACTGTCTCCGG + Intronic
925177860 2:1797812-1797834 GCCTCTCCTGCCACTCTCTGCGG - Intronic
926044046 2:9696710-9696732 CCCTCAGCTGCCTTTCCATGCGG + Intergenic
926163375 2:10503388-10503410 GCCTCAGCTGCCTCTGTCTGAGG + Intergenic
926251393 2:11157147-11157169 CCCTCACCTGCGTATCTCTGAGG - Intronic
926799095 2:16643302-16643324 CTTTCAGCTGCCTTTCTCTGTGG - Intronic
927019335 2:19000740-19000762 CCCTCAGCAGCCCTTCTGTGGGG - Intergenic
927826405 2:26312769-26312791 CTCTCAGACACCACTCTCTGAGG - Intronic
927923056 2:26988739-26988761 CCCACAACTGTCCCTCTCTGAGG + Intronic
928242991 2:29602638-29602660 CCCTCACCTGCCTCCCTCAGGGG + Intronic
928880596 2:36092460-36092482 GCCTCAGCTGCCTCCCTGTGGGG + Intergenic
928950356 2:36808302-36808324 CACCCAGCGGCCACTCACTGAGG - Intronic
930334720 2:50030381-50030403 CCCCCATCTCCCAGTCTCTGTGG + Intronic
933412098 2:81939672-81939694 CCCTCAGCTCTCCCTTTCTGTGG - Intergenic
933760044 2:85666761-85666783 CCGTCAGCTGGGCCTCTCTGAGG + Intronic
933998228 2:87685633-87685655 CCTTCAGCTGCCCCTCTTTCTGG - Intergenic
934755368 2:96820759-96820781 CTCTCTGCAGCCACACTCTGTGG - Intronic
935131672 2:100265328-100265350 CACCCAGCTGACACTCCCTGTGG - Intergenic
935154467 2:100470945-100470967 CCATCAATTTCCACTCTCTGGGG - Intronic
935729437 2:106053261-106053283 CTCCCAGATGCCAGTCTCTGTGG + Intergenic
936061602 2:109298592-109298614 CTTTCAGCTGGCACTCCCTGAGG - Intronic
936241257 2:110790393-110790415 CCCTCAGCTGTCTCACACTGTGG + Intronic
936295622 2:111265240-111265262 CCTTCAGCTGCCCCTCTTTCTGG + Intergenic
937992808 2:127673850-127673872 CCTGCAGATGCCACTCTCCGGGG + Intronic
938210797 2:129464559-129464581 CCCTCAGCTCCCTCCCACTGTGG + Intergenic
938451569 2:131425406-131425428 CCTTCAGCGGCCGCTCGCTGCGG - Intergenic
938778236 2:134560528-134560550 GCCGCAGCTGGCACTTTCTGGGG + Intronic
940032345 2:149277212-149277234 CCCTCATCTGCCTTTCTCAGAGG - Intergenic
940976211 2:159947888-159947910 CAGTCAGCTGCCACTCTCTCTGG - Intronic
942508271 2:176667404-176667426 CTCTCAGCTGCTACACTCAGGGG - Intergenic
943770660 2:191712962-191712984 TCCTCAGCTGGCTCTCTGTGGGG + Intergenic
946826907 2:223688686-223688708 CTCTCAACTGCTCCTCTCTGAGG + Intergenic
946856217 2:223952327-223952349 CCCTCAACAGGCAGTCTCTGTGG + Intergenic
947083115 2:226420812-226420834 CCCTGAGCTCCCACTCACTAAGG - Intergenic
947518000 2:230823743-230823765 CCCTCAGCTGCCAGTGTCCTTGG + Intergenic
947633080 2:231666191-231666213 CCCTCAGCTCCTAGTCTCTTGGG + Intergenic
947994120 2:234512620-234512642 GCCTCTGCTGCCACTCCCTAGGG - Intergenic
1168759751 20:341929-341951 CTCTCAGCTGCCATGCTGTGAGG + Intergenic
1170019728 20:11823656-11823678 CCCTTATCTCCCAGTCTCTGTGG + Intergenic
1172006358 20:31821389-31821411 CCCTCAGCGGCCACAGCCTGTGG - Intronic
1172836100 20:37874107-37874129 CGCTCTCCTGCCCCTCTCTGTGG - Intergenic
1173743551 20:45419402-45419424 CCCCCGGCTGCCAGGCTCTGCGG - Intronic
1174409967 20:50328860-50328882 CCCTCAGATGCCCCTCAGTGGGG - Intergenic
1175293150 20:57891568-57891590 CCCTGAGCTGCCACCCACTGGGG - Intergenic
1178157709 21:29874107-29874129 CACTCGCCTGCCACTCACTGAGG + Intronic
1178448945 21:32674160-32674182 CCCTCATCTTCCACTCTCCCTGG + Intronic
1179246811 21:39640336-39640358 TCCTAAGCAGCCACTCTCTAGGG - Intronic
1179381977 21:40908300-40908322 CCCTCCCCTGCCTCTCACTGGGG + Intergenic
1179489946 21:41734616-41734638 CCCTCAAGTCCCACTCTCTGGGG + Intergenic
1179730617 21:43365407-43365429 CCCTCAGCTCTCACAGTCTGAGG + Intergenic
1180027273 21:45174016-45174038 CCCTTGGCTGCCAATCTTTGAGG - Intronic
1180057185 21:45365062-45365084 CCCTCCCCTCCTACTCTCTGGGG + Intergenic
1181556596 22:23674999-23675021 CCCCCTGCTCCCACTGTCTGGGG - Intergenic
1181618212 22:24069844-24069866 TGTGCAGCTGCCACTCTCTGAGG - Intronic
1181912016 22:26245690-26245712 CAATCAGCGGCCACTCTCAGAGG - Intronic
1182367861 22:29790754-29790776 CCTTCAGCTGCCACCCGCTCAGG - Intronic
1182475690 22:30575157-30575179 GTCTCAGCTGTCACTCTCTAGGG + Intergenic
1182698000 22:32209233-32209255 GCCTCTGCTGGCACTGTCTGGGG - Intergenic
1183481138 22:38066197-38066219 CCCACAGCTGCCACTCCACGTGG + Intronic
1184321386 22:43744609-43744631 CCCTCAGCTCCCACTCCTGGTGG - Intronic
1184887671 22:47356287-47356309 CCACCAGCTGCCACTTTCTGAGG + Intergenic
1185275093 22:49947318-49947340 CCCTCAGTTGCCAATAGCTGTGG - Intergenic
949397910 3:3634756-3634778 CCTTCCGCTGCCACTGTCTCAGG + Intergenic
950105152 3:10383992-10384014 CCCTCAGCCACCCCTCCCTGAGG + Intronic
950166775 3:10806895-10806917 TCTTCAGATGCCTCTCTCTGTGG + Intergenic
950410106 3:12830606-12830628 CACTCTGCTGCCACCCCCTGGGG + Intronic
950892882 3:16420241-16420263 CCCCCAGCTCCCATTCTGTGTGG - Intronic
951141412 3:19166061-19166083 CTTTCAGCTCCCACTCACTGTGG - Intronic
951908804 3:27728947-27728969 CCCTCGACAGCCGCTCTCTGCGG - Intergenic
953117832 3:40010304-40010326 CCCTCAGCTGCCACTCTCAGAGG - Intronic
954327801 3:49873071-49873093 CCCACAGCAGCCACTGTCTGTGG + Intergenic
954671907 3:52295605-52295627 CTATCCTCTGCCACTCTCTGGGG + Intergenic
955379129 3:58422605-58422627 CCCTCAACTCCCAAACTCTGCGG + Intronic
957012036 3:75017868-75017890 ATCTCAGCTGGAACTCTCTGAGG + Intergenic
959315799 3:104805090-104805112 CCATCACCTGCCACTTTCTCTGG - Intergenic
959581931 3:107991365-107991387 CCCTATTCTGCCACCCTCTGTGG - Intergenic
964265359 3:154889378-154889400 GCCTCAGCTGCCTCCCTGTGGGG - Intergenic
964809758 3:160651209-160651231 CCATCATCTCCCACTCTCTCAGG + Intergenic
966626500 3:182022335-182022357 CCCTCAGATTTCACTCTCTCAGG + Intergenic
967234083 3:187367712-187367734 GCCTTAGCTGCCTCTCTGTGGGG - Intergenic
968438705 4:610474-610496 GGCTCCTCTGCCACTCTCTGTGG - Intergenic
969225667 4:5796876-5796898 CCCTCTGCTGCCATCCTCTTAGG - Intronic
969569538 4:8000559-8000581 CCCTCAGGCAGCACTCTCTGGGG + Intronic
969696658 4:8738777-8738799 TCCACAGCTGCTCCTCTCTGGGG - Intergenic
969708897 4:8831564-8831586 TCCTGAGCTGCAAATCTCTGTGG - Intergenic
970606101 4:17683255-17683277 CCATCACTTGCCACTCACTGAGG - Intronic
971511929 4:27437093-27437115 AACTAAGCTGCTACTCTCTGAGG + Intergenic
972918948 4:43914220-43914242 ATCTCTGCTGCCACACTCTGAGG - Intergenic
973636673 4:52867716-52867738 CCCTCAACTGCTATTCACTGTGG - Intergenic
973797868 4:54447305-54447327 CCCTCAGCTGCTGTACTCTGTGG + Intergenic
973961314 4:56112591-56112613 CCCTCGGCTCCCCCTGTCTGAGG + Intergenic
975754836 4:77562087-77562109 GCCTCAGCTGCCTCCCTGTGGGG + Intronic
976004454 4:80412565-80412587 CCTTCAGCTTTCTCTCTCTGAGG - Intronic
978440781 4:108731180-108731202 CCCACAGCTGCCCCTTTCTCTGG + Intergenic
980739278 4:136929213-136929235 GCCTCAGCTGCCTCCCTGTGGGG + Intergenic
982751662 4:159169182-159169204 CCCTCAACTCCCAATCTATGTGG + Intronic
983835378 4:172377677-172377699 GCCTCAGCTGCCTCCCTGTGGGG - Intronic
983953835 4:173674337-173674359 CCCTCAGATACCAAACTCTGTGG + Intergenic
985106539 4:186505331-186505353 CCCTCTGCTGACACTCCCAGTGG - Intronic
985409149 4:189664878-189664900 GCCTCAGCTGCCTCCCTGTGGGG - Intergenic
985556624 5:561742-561764 CCGTCAGCTGCGCCCCTCTGCGG - Intergenic
985556648 5:561828-561850 CCGTCAGCTGCGCCCCTCTGCGG - Intergenic
985556736 5:562129-562151 CCGTCAGCTGCGCCCCTCTGCGG - Intergenic
985556760 5:562215-562237 CCGTCAGCTGCGCCCCTCTGCGG - Intergenic
985556772 5:562258-562280 CCGTCAGCTGCGCCCCTCTGCGG - Intergenic
985556807 5:562387-562409 CCGTCAGCTGCGCCCCTCTGCGG - Intergenic
985556819 5:562430-562452 CCGTCAGCTGCGCCCCTCTGCGG - Intergenic
985556890 5:562689-562711 CCGTCAGCTGCGCCCCTCTGCGG - Intergenic
985556902 5:562732-562754 CCGTCAGCTGCGCCCCTCTGCGG - Intergenic
985556973 5:562991-563013 CCGTCAGCTGCGCCCCTCTGCGG - Intergenic
985556985 5:563034-563056 CCGTCAGCTGCGCCCCTCTGCGG - Intergenic
985557069 5:563336-563358 CCGTCAGCTGCGCCCCTCTGCGG - Intergenic
985557081 5:563379-563401 CCGTCAGCTGCGCCCCTCTGCGG - Intergenic
985557116 5:563508-563530 CCGTCAGCTGCGCCCCTCTGCGG - Intergenic
985557128 5:563551-563573 CCGTCAGCTGCGCCCCTCTGCGG - Intergenic
985557483 5:564755-564777 CCGTCAGCTGCGCCCCTCTGCGG - Intergenic
985557640 5:565316-565338 CCCTCAGCTGAACCCCTCTGCGG - Intergenic
985557762 5:565748-565770 CCCTCAGCCGCGCCCCTCTGCGG - Intergenic
985563097 5:601845-601867 CCATCACCTGCCCCTCACTGGGG - Intergenic
988227978 5:28438218-28438240 CCCTCAACTTCCCCTTTCTGTGG - Intergenic
989104590 5:37849612-37849634 CCCTCTGCCGCCTCGCTCTGTGG - Intergenic
990218184 5:53557836-53557858 CCCTCAGCTGCCCATTCCTGAGG - Intergenic
990371044 5:55118747-55118769 TCTTCAGCTGTCACACTCTGTGG - Intronic
992000612 5:72432550-72432572 CCCTCAGCTGCTGCTCAGTGGGG - Intergenic
992181428 5:74201739-74201761 CCCTCAGCCTCTATTCTCTGGGG - Intergenic
993224403 5:85148751-85148773 CCCTCACCTCCTACTCCCTGTGG + Intergenic
994132651 5:96247972-96247994 CCCTCAGTAGCCACTCGGTGGGG + Intergenic
994733200 5:103519162-103519184 CTCTCAGTTGCCACTGACTGTGG + Intergenic
994909187 5:105880548-105880570 ACCTAAGTTTCCACTCTCTGTGG + Intergenic
997158178 5:131580174-131580196 GCCTCAGCTGCCTCTCCATGGGG - Intronic
998005931 5:138657071-138657093 CCCTCAGTTCCCACTCTCCAGGG + Intronic
998923712 5:147099475-147099497 CCCTGAGCTGCCATCATCTGGGG - Intergenic
1002337900 5:178493176-178493198 CCCTCAGCTCCCATCTTCTGTGG + Intronic
1002419866 5:179139842-179139864 CCCTCAGCTGCCACTCAGCAAGG + Intronic
1003074101 6:2968612-2968634 CCCTGCGCTGCCTATCTCTGGGG + Intronic
1004152964 6:13138215-13138237 CCCCCATCTTCCAGTCTCTGGGG - Intronic
1005429162 6:25736147-25736169 ATCTCAGATTCCACTCTCTGAGG + Intergenic
1006093079 6:31639607-31639629 CCCCCAGCTGCTTCTCTCAGAGG - Exonic
1007311175 6:40947217-40947239 CCCTAACCTGCCTCTCTCAGAGG - Intergenic
1007607244 6:43125876-43125898 CCCTTAGCTGCTCCTCTGTGTGG + Intronic
1009278432 6:61716154-61716176 CCCTGAGCTGCCATGCTATGAGG + Intronic
1010942310 6:81933248-81933270 CTCTCTCCAGCCACTCTCTGTGG - Intergenic
1012145039 6:95670261-95670283 GCCTCAGCTGCCTCCCTGTGGGG + Intergenic
1013974143 6:116058031-116058053 TCCTCATCTGCAACTCTCTGGGG - Intronic
1014016062 6:116531479-116531501 CCCTCAGCAGCAAGTCTTTGTGG - Intronic
1016225407 6:141729413-141729435 CCCTTATCTTCCAGTCTCTGTGG + Intergenic
1017099876 6:150838959-150838981 CCCTCCACTGCCATTGTCTGGGG - Intronic
1018208615 6:161459067-161459089 CTGTCAGCAGACACTCTCTGAGG - Intronic
1018722837 6:166586883-166586905 CCCTCAGCTGCCTCCCAGTGGGG + Intronic
1019410564 7:904856-904878 GCCTCAGCTGCCCCACCCTGGGG + Intronic
1019623108 7:2002206-2002228 CCCGCAGCCTCCACTCTCTGGGG + Intronic
1019922554 7:4172192-4172214 CCAGCAGCTGTCCCTCTCTGAGG - Intronic
1020271398 7:6598599-6598621 TCCTCAGCCCCCTCTCTCTGGGG - Intronic
1021729934 7:23586308-23586330 CCCCCGGCTGCCTCGCTCTGAGG + Intergenic
1021786231 7:24155511-24155533 CCCTCAGCTGTCACTCTGCTTGG - Intergenic
1022847520 7:34225960-34225982 CCTTCAGCTCCTGCTCTCTGTGG + Intergenic
1026873822 7:73868787-73868809 CCCTCGGCTGCCACTCACAATGG + Intergenic
1028353632 7:89880094-89880116 ACCTCATCTTCCAGTCTCTGTGG - Intergenic
1028719400 7:94012008-94012030 GCCTCAGCTGCCTCCCTGTGGGG - Intergenic
1029053734 7:97717904-97717926 CCCTCACCTGCCCCTCTTTGTGG - Intergenic
1029158146 7:98531945-98531967 CCCTCTGCTCCCACTCCCTTGGG - Intergenic
1029735213 7:102461917-102461939 CCCTGGGCTGCCACTCACTGTGG + Intronic
1030148310 7:106378436-106378458 CCCTCTGCTCCGACTCCCTGCGG - Intergenic
1030547096 7:110909632-110909654 CTCTCAGAGGCTACTCTCTGGGG + Intronic
1031965463 7:128025024-128025046 CCCTTAGCTGTCACCCTCTGTGG + Intronic
1032087369 7:128891149-128891171 CCCTCGGCTGCTCCTCCCTGGGG - Intronic
1034475942 7:151282076-151282098 CCCTCAACTGGCAGCCTCTGGGG + Intergenic
1034581736 7:152049876-152049898 CCCTTAGCTGCCACTGTCCTAGG + Intronic
1035472212 7:159117687-159117709 CCCTCAGCTGCCACTCTCTGTGG - Intronic
1035934119 8:3818123-3818145 CCCTTAGCTGAAACTCTCTTTGG - Intronic
1037121218 8:15289638-15289660 CCCTCAGATAACACTCACTGTGG - Intergenic
1037727261 8:21493116-21493138 CCTTCAGATGTCACTCACTGCGG - Intergenic
1037819788 8:22130090-22130112 CCCTCCCTTGCCTCTCTCTGGGG - Intronic
1038311713 8:26450058-26450080 CCTACAGCTGCCCCTCTCTCAGG - Intronic
1039969462 8:42308856-42308878 ACCTGAGCTGCTCCTCTCTGGGG - Intronic
1041726628 8:61023879-61023901 GCCTCAGCAGCCAGTCTCTCCGG - Intergenic
1042952931 8:74220092-74220114 CCCTCAGCTGCCAGTCCTTTGGG + Intergenic
1043385718 8:79745854-79745876 CCCTCAGCTGGTACATTCTGGGG - Intergenic
1043628982 8:82303760-82303782 TCCTCATCTCCCAGTCTCTGTGG - Intergenic
1044727917 8:95208150-95208172 CCCTCGGCTGCAGGTCTCTGAGG - Intergenic
1044734191 8:95261418-95261440 CTCTAAGCTGGCACACTCTGAGG + Intronic
1044853582 8:96452500-96452522 GCCTCAGCTGCCTCCCTGTGAGG + Intergenic
1047213287 8:122856993-122857015 CTGACAGCTGCCAGTCTCTGGGG + Intronic
1047325197 8:123829281-123829303 CCCTCACCTTCCACTTACTGGGG + Intergenic
1047431711 8:124798770-124798792 CCCACAGGTGCCTCTCTCAGTGG + Intergenic
1050012982 9:1204204-1204226 CCCTGACCTGCAACTCTCTGTGG - Intergenic
1052221306 9:26026582-26026604 CCCTTACCTGCCAGTCTCTGTGG - Intergenic
1052549005 9:29923224-29923246 GCCTCATCTTCCAGTCTCTGTGG - Intergenic
1057443635 9:95098976-95098998 CCCGAAGCTTCCACTGTCTGGGG + Intergenic
1057918117 9:99073222-99073244 TCCTCTGGAGCCACTCTCTGGGG - Intergenic
1058101940 9:100925842-100925864 CTCTCTCCTGCCACTCTGTGAGG + Intergenic
1061407579 9:130400963-130400985 CCCTCAGCTGCCTCTCTCTGTGG - Intronic
1062033558 9:134372736-134372758 CCCTGTGCTGCCACCCTCTGAGG - Intronic
1203662395 Un_KI270753v1:57552-57574 GCCTCAGCTGCCTCCCTGTGGGG + Intergenic
1186705312 X:12134551-12134573 CCCTCAGCTGCCAACCTATATGG + Intergenic
1189105829 X:38234218-38234240 CTCTAAGCTGCCTCTCCCTGTGG + Intronic
1191108892 X:56789664-56789686 CCTTCAGCTACCTCTCTCTCTGG + Intergenic
1192367589 X:70487270-70487292 CCCCAACCTGCCATTCTCTGAGG + Intronic
1195674085 X:107493985-107494007 TTCTCAGTGGCCACTCTCTGTGG + Intergenic
1198054907 X:132984476-132984498 CCCTCTGATGCCACTCACAGTGG + Intergenic
1198191522 X:134311604-134311626 CTCACAGCTGCCACCATCTGGGG - Intergenic
1198676407 X:139135825-139135847 CACTCAACTGCCACCCTATGGGG + Intronic
1200814807 Y:7520151-7520173 CAATCAGCTGACATTCTCTGGGG - Intergenic
1201488175 Y:14513033-14513055 GCCTCAGCTGCCTTCCTCTGGGG + Intergenic