ID: 1035477500

View in Genome Browser
Species Human (GRCh38)
Location 7:159153638-159153660
Sequence GGCTGAGGAGGAGGGGAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035477500_1035477521 30 Left 1035477500 7:159153638-159153660 CCCCTTTCCCCTCCTCCTCAGCC No data
Right 1035477521 7:159153691-159153713 CTGTAGCTCTGGAGAACAGAAGG No data
1035477500_1035477519 19 Left 1035477500 7:159153638-159153660 CCCCTTTCCCCTCCTCCTCAGCC No data
Right 1035477519 7:159153680-159153702 AGGATGAAGGCCTGTAGCTCTGG No data
1035477500_1035477518 6 Left 1035477500 7:159153638-159153660 CCCCTTTCCCCTCCTCCTCAGCC No data
Right 1035477518 7:159153667-159153689 GGTGGGGACGAGGAGGATGAAGG No data
1035477500_1035477515 -1 Left 1035477500 7:159153638-159153660 CCCCTTTCCCCTCCTCCTCAGCC No data
Right 1035477515 7:159153660-159153682 CCCTCCAGGTGGGGACGAGGAGG No data
1035477500_1035477512 -4 Left 1035477500 7:159153638-159153660 CCCCTTTCCCCTCCTCCTCAGCC No data
Right 1035477512 7:159153657-159153679 AGCCCCTCCAGGTGGGGACGAGG No data
1035477500_1035477510 -10 Left 1035477500 7:159153638-159153660 CCCCTTTCCCCTCCTCCTCAGCC No data
Right 1035477510 7:159153651-159153673 CTCCTCAGCCCCTCCAGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035477500 Original CRISPR GGCTGAGGAGGAGGGGAAAG GGG (reversed) Intergenic
No off target data available for this crispr