ID: 1035477501

View in Genome Browser
Species Human (GRCh38)
Location 7:159153639-159153661
Sequence GGGCTGAGGAGGAGGGGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035477501_1035477519 18 Left 1035477501 7:159153639-159153661 CCCTTTCCCCTCCTCCTCAGCCC No data
Right 1035477519 7:159153680-159153702 AGGATGAAGGCCTGTAGCTCTGG No data
1035477501_1035477518 5 Left 1035477501 7:159153639-159153661 CCCTTTCCCCTCCTCCTCAGCCC No data
Right 1035477518 7:159153667-159153689 GGTGGGGACGAGGAGGATGAAGG No data
1035477501_1035477521 29 Left 1035477501 7:159153639-159153661 CCCTTTCCCCTCCTCCTCAGCCC No data
Right 1035477521 7:159153691-159153713 CTGTAGCTCTGGAGAACAGAAGG No data
1035477501_1035477512 -5 Left 1035477501 7:159153639-159153661 CCCTTTCCCCTCCTCCTCAGCCC No data
Right 1035477512 7:159153657-159153679 AGCCCCTCCAGGTGGGGACGAGG No data
1035477501_1035477515 -2 Left 1035477501 7:159153639-159153661 CCCTTTCCCCTCCTCCTCAGCCC No data
Right 1035477515 7:159153660-159153682 CCCTCCAGGTGGGGACGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035477501 Original CRISPR GGGCTGAGGAGGAGGGGAAA GGG (reversed) Intergenic
No off target data available for this crispr