ID: 1035477504

View in Genome Browser
Species Human (GRCh38)
Location 7:159153646-159153668
Sequence CCTGGAGGGGCTGAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035477504_1035477519 11 Left 1035477504 7:159153646-159153668 CCCTCCTCCTCAGCCCCTCCAGG No data
Right 1035477519 7:159153680-159153702 AGGATGAAGGCCTGTAGCTCTGG No data
1035477504_1035477521 22 Left 1035477504 7:159153646-159153668 CCCTCCTCCTCAGCCCCTCCAGG No data
Right 1035477521 7:159153691-159153713 CTGTAGCTCTGGAGAACAGAAGG No data
1035477504_1035477515 -9 Left 1035477504 7:159153646-159153668 CCCTCCTCCTCAGCCCCTCCAGG No data
Right 1035477515 7:159153660-159153682 CCCTCCAGGTGGGGACGAGGAGG No data
1035477504_1035477518 -2 Left 1035477504 7:159153646-159153668 CCCTCCTCCTCAGCCCCTCCAGG No data
Right 1035477518 7:159153667-159153689 GGTGGGGACGAGGAGGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035477504 Original CRISPR CCTGGAGGGGCTGAGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr