ID: 1035477508

View in Genome Browser
Species Human (GRCh38)
Location 7:159153650-159153672
Sequence CCCACCTGGAGGGGCTGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035477508_1035477523 30 Left 1035477508 7:159153650-159153672 CCTCCTCAGCCCCTCCAGGTGGG No data
Right 1035477523 7:159153703-159153725 AGAACAGAAGGCAAGCTTGGAGG No data
1035477508_1035477522 27 Left 1035477508 7:159153650-159153672 CCTCCTCAGCCCCTCCAGGTGGG No data
Right 1035477522 7:159153700-159153722 TGGAGAACAGAAGGCAAGCTTGG No data
1035477508_1035477519 7 Left 1035477508 7:159153650-159153672 CCTCCTCAGCCCCTCCAGGTGGG No data
Right 1035477519 7:159153680-159153702 AGGATGAAGGCCTGTAGCTCTGG No data
1035477508_1035477518 -6 Left 1035477508 7:159153650-159153672 CCTCCTCAGCCCCTCCAGGTGGG No data
Right 1035477518 7:159153667-159153689 GGTGGGGACGAGGAGGATGAAGG No data
1035477508_1035477521 18 Left 1035477508 7:159153650-159153672 CCTCCTCAGCCCCTCCAGGTGGG No data
Right 1035477521 7:159153691-159153713 CTGTAGCTCTGGAGAACAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035477508 Original CRISPR CCCACCTGGAGGGGCTGAGG AGG (reversed) Intergenic
No off target data available for this crispr