ID: 1035477511

View in Genome Browser
Species Human (GRCh38)
Location 7:159153653-159153675
Sequence GTCCCCACCTGGAGGGGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035477511_1035477523 27 Left 1035477511 7:159153653-159153675 CCTCAGCCCCTCCAGGTGGGGAC No data
Right 1035477523 7:159153703-159153725 AGAACAGAAGGCAAGCTTGGAGG No data
1035477511_1035477518 -9 Left 1035477511 7:159153653-159153675 CCTCAGCCCCTCCAGGTGGGGAC No data
Right 1035477518 7:159153667-159153689 GGTGGGGACGAGGAGGATGAAGG No data
1035477511_1035477522 24 Left 1035477511 7:159153653-159153675 CCTCAGCCCCTCCAGGTGGGGAC No data
Right 1035477522 7:159153700-159153722 TGGAGAACAGAAGGCAAGCTTGG No data
1035477511_1035477524 30 Left 1035477511 7:159153653-159153675 CCTCAGCCCCTCCAGGTGGGGAC No data
Right 1035477524 7:159153706-159153728 ACAGAAGGCAAGCTTGGAGGCGG No data
1035477511_1035477521 15 Left 1035477511 7:159153653-159153675 CCTCAGCCCCTCCAGGTGGGGAC No data
Right 1035477521 7:159153691-159153713 CTGTAGCTCTGGAGAACAGAAGG No data
1035477511_1035477519 4 Left 1035477511 7:159153653-159153675 CCTCAGCCCCTCCAGGTGGGGAC No data
Right 1035477519 7:159153680-159153702 AGGATGAAGGCCTGTAGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035477511 Original CRISPR GTCCCCACCTGGAGGGGCTG AGG (reversed) Intergenic
No off target data available for this crispr