ID: 1035477514

View in Genome Browser
Species Human (GRCh38)
Location 7:159153660-159153682
Sequence CCTCCTCGTCCCCACCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035477514_1035477521 8 Left 1035477514 7:159153660-159153682 CCCTCCAGGTGGGGACGAGGAGG No data
Right 1035477521 7:159153691-159153713 CTGTAGCTCTGGAGAACAGAAGG No data
1035477514_1035477519 -3 Left 1035477514 7:159153660-159153682 CCCTCCAGGTGGGGACGAGGAGG No data
Right 1035477519 7:159153680-159153702 AGGATGAAGGCCTGTAGCTCTGG No data
1035477514_1035477523 20 Left 1035477514 7:159153660-159153682 CCCTCCAGGTGGGGACGAGGAGG No data
Right 1035477523 7:159153703-159153725 AGAACAGAAGGCAAGCTTGGAGG No data
1035477514_1035477524 23 Left 1035477514 7:159153660-159153682 CCCTCCAGGTGGGGACGAGGAGG No data
Right 1035477524 7:159153706-159153728 ACAGAAGGCAAGCTTGGAGGCGG No data
1035477514_1035477522 17 Left 1035477514 7:159153660-159153682 CCCTCCAGGTGGGGACGAGGAGG No data
Right 1035477522 7:159153700-159153722 TGGAGAACAGAAGGCAAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035477514 Original CRISPR CCTCCTCGTCCCCACCTGGA GGG (reversed) Intergenic
No off target data available for this crispr