ID: 1035477515

View in Genome Browser
Species Human (GRCh38)
Location 7:159153660-159153682
Sequence CCCTCCAGGTGGGGACGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035477497_1035477515 8 Left 1035477497 7:159153629-159153651 CCAAGCCCTCCCCTTTCCCCTCC No data
Right 1035477515 7:159153660-159153682 CCCTCCAGGTGGGGACGAGGAGG No data
1035477500_1035477515 -1 Left 1035477500 7:159153638-159153660 CCCCTTTCCCCTCCTCCTCAGCC No data
Right 1035477515 7:159153660-159153682 CCCTCCAGGTGGGGACGAGGAGG No data
1035477494_1035477515 27 Left 1035477494 7:159153610-159153632 CCACCCTGAGACAGCAGGACCAA No data
Right 1035477515 7:159153660-159153682 CCCTCCAGGTGGGGACGAGGAGG No data
1035477502_1035477515 -3 Left 1035477502 7:159153640-159153662 CCTTTCCCCTCCTCCTCAGCCCC No data
Right 1035477515 7:159153660-159153682 CCCTCCAGGTGGGGACGAGGAGG No data
1035477501_1035477515 -2 Left 1035477501 7:159153639-159153661 CCCTTTCCCCTCCTCCTCAGCCC No data
Right 1035477515 7:159153660-159153682 CCCTCCAGGTGGGGACGAGGAGG No data
1035477495_1035477515 24 Left 1035477495 7:159153613-159153635 CCCTGAGACAGCAGGACCAAGCC No data
Right 1035477515 7:159153660-159153682 CCCTCCAGGTGGGGACGAGGAGG No data
1035477503_1035477515 -8 Left 1035477503 7:159153645-159153667 CCCCTCCTCCTCAGCCCCTCCAG No data
Right 1035477515 7:159153660-159153682 CCCTCCAGGTGGGGACGAGGAGG No data
1035477504_1035477515 -9 Left 1035477504 7:159153646-159153668 CCCTCCTCCTCAGCCCCTCCAGG No data
Right 1035477515 7:159153660-159153682 CCCTCCAGGTGGGGACGAGGAGG No data
1035477506_1035477515 -10 Left 1035477506 7:159153647-159153669 CCTCCTCCTCAGCCCCTCCAGGT No data
Right 1035477515 7:159153660-159153682 CCCTCCAGGTGGGGACGAGGAGG No data
1035477496_1035477515 23 Left 1035477496 7:159153614-159153636 CCTGAGACAGCAGGACCAAGCCC No data
Right 1035477515 7:159153660-159153682 CCCTCCAGGTGGGGACGAGGAGG No data
1035477499_1035477515 2 Left 1035477499 7:159153635-159153657 CCTCCCCTTTCCCCTCCTCCTCA No data
Right 1035477515 7:159153660-159153682 CCCTCCAGGTGGGGACGAGGAGG No data
1035477498_1035477515 3 Left 1035477498 7:159153634-159153656 CCCTCCCCTTTCCCCTCCTCCTC No data
Right 1035477515 7:159153660-159153682 CCCTCCAGGTGGGGACGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035477515 Original CRISPR CCCTCCAGGTGGGGACGAGG AGG Intergenic
No off target data available for this crispr