ID: 1035477519

View in Genome Browser
Species Human (GRCh38)
Location 7:159153680-159153702
Sequence AGGATGAAGGCCTGTAGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035477502_1035477519 17 Left 1035477502 7:159153640-159153662 CCTTTCCCCTCCTCCTCAGCCCC No data
Right 1035477519 7:159153680-159153702 AGGATGAAGGCCTGTAGCTCTGG No data
1035477501_1035477519 18 Left 1035477501 7:159153639-159153661 CCCTTTCCCCTCCTCCTCAGCCC No data
Right 1035477519 7:159153680-159153702 AGGATGAAGGCCTGTAGCTCTGG No data
1035477508_1035477519 7 Left 1035477508 7:159153650-159153672 CCTCCTCAGCCCCTCCAGGTGGG No data
Right 1035477519 7:159153680-159153702 AGGATGAAGGCCTGTAGCTCTGG No data
1035477517_1035477519 -7 Left 1035477517 7:159153664-159153686 CCAGGTGGGGACGAGGAGGATGA No data
Right 1035477519 7:159153680-159153702 AGGATGAAGGCCTGTAGCTCTGG No data
1035477497_1035477519 28 Left 1035477497 7:159153629-159153651 CCAAGCCCTCCCCTTTCCCCTCC No data
Right 1035477519 7:159153680-159153702 AGGATGAAGGCCTGTAGCTCTGG No data
1035477499_1035477519 22 Left 1035477499 7:159153635-159153657 CCTCCCCTTTCCCCTCCTCCTCA No data
Right 1035477519 7:159153680-159153702 AGGATGAAGGCCTGTAGCTCTGG No data
1035477506_1035477519 10 Left 1035477506 7:159153647-159153669 CCTCCTCCTCAGCCCCTCCAGGT No data
Right 1035477519 7:159153680-159153702 AGGATGAAGGCCTGTAGCTCTGG No data
1035477511_1035477519 4 Left 1035477511 7:159153653-159153675 CCTCAGCCCCTCCAGGTGGGGAC No data
Right 1035477519 7:159153680-159153702 AGGATGAAGGCCTGTAGCTCTGG No data
1035477514_1035477519 -3 Left 1035477514 7:159153660-159153682 CCCTCCAGGTGGGGACGAGGAGG No data
Right 1035477519 7:159153680-159153702 AGGATGAAGGCCTGTAGCTCTGG No data
1035477498_1035477519 23 Left 1035477498 7:159153634-159153656 CCCTCCCCTTTCCCCTCCTCCTC No data
Right 1035477519 7:159153680-159153702 AGGATGAAGGCCTGTAGCTCTGG No data
1035477500_1035477519 19 Left 1035477500 7:159153638-159153660 CCCCTTTCCCCTCCTCCTCAGCC No data
Right 1035477519 7:159153680-159153702 AGGATGAAGGCCTGTAGCTCTGG No data
1035477513_1035477519 -2 Left 1035477513 7:159153659-159153681 CCCCTCCAGGTGGGGACGAGGAG No data
Right 1035477519 7:159153680-159153702 AGGATGAAGGCCTGTAGCTCTGG No data
1035477516_1035477519 -4 Left 1035477516 7:159153661-159153683 CCTCCAGGTGGGGACGAGGAGGA No data
Right 1035477519 7:159153680-159153702 AGGATGAAGGCCTGTAGCTCTGG No data
1035477503_1035477519 12 Left 1035477503 7:159153645-159153667 CCCCTCCTCCTCAGCCCCTCCAG No data
Right 1035477519 7:159153680-159153702 AGGATGAAGGCCTGTAGCTCTGG No data
1035477504_1035477519 11 Left 1035477504 7:159153646-159153668 CCCTCCTCCTCAGCCCCTCCAGG No data
Right 1035477519 7:159153680-159153702 AGGATGAAGGCCTGTAGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035477519 Original CRISPR AGGATGAAGGCCTGTAGCTC TGG Intergenic
No off target data available for this crispr