ID: 1035477521

View in Genome Browser
Species Human (GRCh38)
Location 7:159153691-159153713
Sequence CTGTAGCTCTGGAGAACAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035477503_1035477521 23 Left 1035477503 7:159153645-159153667 CCCCTCCTCCTCAGCCCCTCCAG No data
Right 1035477521 7:159153691-159153713 CTGTAGCTCTGGAGAACAGAAGG No data
1035477504_1035477521 22 Left 1035477504 7:159153646-159153668 CCCTCCTCCTCAGCCCCTCCAGG No data
Right 1035477521 7:159153691-159153713 CTGTAGCTCTGGAGAACAGAAGG No data
1035477506_1035477521 21 Left 1035477506 7:159153647-159153669 CCTCCTCCTCAGCCCCTCCAGGT No data
Right 1035477521 7:159153691-159153713 CTGTAGCTCTGGAGAACAGAAGG No data
1035477500_1035477521 30 Left 1035477500 7:159153638-159153660 CCCCTTTCCCCTCCTCCTCAGCC No data
Right 1035477521 7:159153691-159153713 CTGTAGCTCTGGAGAACAGAAGG No data
1035477508_1035477521 18 Left 1035477508 7:159153650-159153672 CCTCCTCAGCCCCTCCAGGTGGG No data
Right 1035477521 7:159153691-159153713 CTGTAGCTCTGGAGAACAGAAGG No data
1035477516_1035477521 7 Left 1035477516 7:159153661-159153683 CCTCCAGGTGGGGACGAGGAGGA No data
Right 1035477521 7:159153691-159153713 CTGTAGCTCTGGAGAACAGAAGG No data
1035477501_1035477521 29 Left 1035477501 7:159153639-159153661 CCCTTTCCCCTCCTCCTCAGCCC No data
Right 1035477521 7:159153691-159153713 CTGTAGCTCTGGAGAACAGAAGG No data
1035477517_1035477521 4 Left 1035477517 7:159153664-159153686 CCAGGTGGGGACGAGGAGGATGA No data
Right 1035477521 7:159153691-159153713 CTGTAGCTCTGGAGAACAGAAGG No data
1035477513_1035477521 9 Left 1035477513 7:159153659-159153681 CCCCTCCAGGTGGGGACGAGGAG No data
Right 1035477521 7:159153691-159153713 CTGTAGCTCTGGAGAACAGAAGG No data
1035477502_1035477521 28 Left 1035477502 7:159153640-159153662 CCTTTCCCCTCCTCCTCAGCCCC No data
Right 1035477521 7:159153691-159153713 CTGTAGCTCTGGAGAACAGAAGG No data
1035477514_1035477521 8 Left 1035477514 7:159153660-159153682 CCCTCCAGGTGGGGACGAGGAGG No data
Right 1035477521 7:159153691-159153713 CTGTAGCTCTGGAGAACAGAAGG No data
1035477511_1035477521 15 Left 1035477511 7:159153653-159153675 CCTCAGCCCCTCCAGGTGGGGAC No data
Right 1035477521 7:159153691-159153713 CTGTAGCTCTGGAGAACAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035477521 Original CRISPR CTGTAGCTCTGGAGAACAGA AGG Intergenic
No off target data available for this crispr